ID: 949048090

View in Genome Browser
Species Human (GRCh38)
Location 2:241881461-241881483
Sequence CGGAGGAGGCCGCTGTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048069_949048090 29 Left 949048069 2:241881409-241881431 CCCGGGGGCCTACCAGAGCCCAC 0: 1
1: 0
2: 1
3: 17
4: 201
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048070_949048090 28 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048078_949048090 7 Left 949048078 2:241881431-241881453 CCTGGACCCCACACTGGGTCAGC No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048077_949048090 10 Left 949048077 2:241881428-241881450 CCACCTGGACCCCACACTGGGTC No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048073_949048090 17 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048080_949048090 1 Left 949048080 2:241881437-241881459 CCCCACACTGGGTCAGCCCTGGT No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048081_949048090 0 Left 949048081 2:241881438-241881460 CCCACACTGGGTCAGCCCTGGTG No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048082_949048090 -1 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048076_949048090 11 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048072_949048090 21 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048090 Original CRISPR CGGAGGAGGCCGCTGTAGGT GGG Intergenic