ID: 949048091

View in Genome Browser
Species Human (GRCh38)
Location 2:241881466-241881488
Sequence GAGGCCGCTGTAGGTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048073_949048091 22 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048086_949048091 -10 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048081_949048091 5 Left 949048081 2:241881438-241881460 CCCACACTGGGTCAGCCCTGGTG No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048082_949048091 4 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048072_949048091 26 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048077_949048091 15 Left 949048077 2:241881428-241881450 CCACCTGGACCCCACACTGGGTC No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048076_949048091 16 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048078_949048091 12 Left 949048078 2:241881431-241881453 CCTGGACCCCACACTGGGTCAGC No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048080_949048091 6 Left 949048080 2:241881437-241881459 CCCCACACTGGGTCAGCCCTGGT No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048091 Original CRISPR GAGGCCGCTGTAGGTGGGCA CGG Intergenic