ID: 949048093

View in Genome Browser
Species Human (GRCh38)
Location 2:241881468-241881490
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 151}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048077_949048093 17 Left 949048077 2:241881428-241881450 CCACCTGGACCCCACACTGGGTC No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG 0: 1
1: 0
2: 2
3: 4
4: 151
949048073_949048093 24 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG 0: 1
1: 0
2: 2
3: 4
4: 151
949048082_949048093 6 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC 0: 1
1: 0
2: 3
3: 24
4: 236
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG 0: 1
1: 0
2: 2
3: 4
4: 151
949048087_949048093 -9 Left 949048087 2:241881454-241881476 CCTGGTGCGGAGGAGGCCGCTGT No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG 0: 1
1: 0
2: 2
3: 4
4: 151
949048086_949048093 -8 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG 0: 1
1: 0
2: 2
3: 4
4: 151
949048076_949048093 18 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG 0: 1
1: 0
2: 2
3: 4
4: 151
949048078_949048093 14 Left 949048078 2:241881431-241881453 CCTGGACCCCACACTGGGTCAGC No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG 0: 1
1: 0
2: 2
3: 4
4: 151
949048080_949048093 8 Left 949048080 2:241881437-241881459 CCCCACACTGGGTCAGCCCTGGT No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG 0: 1
1: 0
2: 2
3: 4
4: 151
949048081_949048093 7 Left 949048081 2:241881438-241881460 CCCACACTGGGTCAGCCCTGGTG No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG 0: 1
1: 0
2: 2
3: 4
4: 151
949048072_949048093 28 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG 0: 1
1: 0
2: 2
3: 4
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type