ID: 949048094

View in Genome Browser
Species Human (GRCh38)
Location 2:241881470-241881492
Sequence TGCCCCGTGCCCACCTACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048094_949048095 -10 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048095 2:241881483-241881505 GCACGGGGCAGCACGCGTTAAGG No data
949048094_949048096 -9 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048096 2:241881484-241881506 CACGGGGCAGCACGCGTTAAGGG No data
949048094_949048104 7 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048104 2:241881500-241881522 TTAAGGGGCTGGACGGGGGGTGG No data
949048094_949048105 21 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048105 2:241881514-241881536 GGGGGGTGGCCATGCGTGTGAGG No data
949048094_949048101 2 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048101 2:241881495-241881517 ACGCGTTAAGGGGCTGGACGGGG No data
949048094_949048100 1 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048100 2:241881494-241881516 CACGCGTTAAGGGGCTGGACGGG No data
949048094_949048102 3 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048102 2:241881496-241881518 CGCGTTAAGGGGCTGGACGGGGG No data
949048094_949048098 -4 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048098 2:241881489-241881511 GGCAGCACGCGTTAAGGGGCTGG No data
949048094_949048099 0 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048099 2:241881493-241881515 GCACGCGTTAAGGGGCTGGACGG No data
949048094_949048106 22 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048106 2:241881515-241881537 GGGGGTGGCCATGCGTGTGAGGG No data
949048094_949048103 4 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048103 2:241881497-241881519 GCGTTAAGGGGCTGGACGGGGGG No data
949048094_949048097 -8 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048097 2:241881485-241881507 ACGGGGCAGCACGCGTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048094 Original CRISPR TGCCCCGTGCCCACCTACAG CGG (reversed) Intergenic