ID: 949048095

View in Genome Browser
Species Human (GRCh38)
Location 2:241881483-241881505
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048082_949048095 21 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048095 2:241881483-241881505 GCACGGGGCAGCACGCGTTAAGG No data
949048078_949048095 29 Left 949048078 2:241881431-241881453 CCTGGACCCCACACTGGGTCAGC No data
Right 949048095 2:241881483-241881505 GCACGGGGCAGCACGCGTTAAGG No data
949048087_949048095 6 Left 949048087 2:241881454-241881476 CCTGGTGCGGAGGAGGCCGCTGT No data
Right 949048095 2:241881483-241881505 GCACGGGGCAGCACGCGTTAAGG No data
949048080_949048095 23 Left 949048080 2:241881437-241881459 CCCCACACTGGGTCAGCCCTGGT No data
Right 949048095 2:241881483-241881505 GCACGGGGCAGCACGCGTTAAGG No data
949048094_949048095 -10 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048095 2:241881483-241881505 GCACGGGGCAGCACGCGTTAAGG No data
949048081_949048095 22 Left 949048081 2:241881438-241881460 CCCACACTGGGTCAGCCCTGGTG No data
Right 949048095 2:241881483-241881505 GCACGGGGCAGCACGCGTTAAGG No data
949048086_949048095 7 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048095 2:241881483-241881505 GCACGGGGCAGCACGCGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type