ID: 949048098

View in Genome Browser
Species Human (GRCh38)
Location 2:241881489-241881511
Sequence GGCAGCACGCGTTAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048081_949048098 28 Left 949048081 2:241881438-241881460 CCCACACTGGGTCAGCCCTGGTG No data
Right 949048098 2:241881489-241881511 GGCAGCACGCGTTAAGGGGCTGG No data
949048087_949048098 12 Left 949048087 2:241881454-241881476 CCTGGTGCGGAGGAGGCCGCTGT No data
Right 949048098 2:241881489-241881511 GGCAGCACGCGTTAAGGGGCTGG No data
949048094_949048098 -4 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048098 2:241881489-241881511 GGCAGCACGCGTTAAGGGGCTGG No data
949048082_949048098 27 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC 0: 1
1: 0
2: 3
3: 24
4: 236
Right 949048098 2:241881489-241881511 GGCAGCACGCGTTAAGGGGCTGG No data
949048080_949048098 29 Left 949048080 2:241881437-241881459 CCCCACACTGGGTCAGCCCTGGT No data
Right 949048098 2:241881489-241881511 GGCAGCACGCGTTAAGGGGCTGG No data
949048086_949048098 13 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048098 2:241881489-241881511 GGCAGCACGCGTTAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048098 Original CRISPR GGCAGCACGCGTTAAGGGGC TGG Intergenic