ID: 949048099

View in Genome Browser
Species Human (GRCh38)
Location 2:241881493-241881515
Sequence GCACGCGTTAAGGGGCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048086_949048099 17 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048099 2:241881493-241881515 GCACGCGTTAAGGGGCTGGACGG No data
949048094_949048099 0 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048099 2:241881493-241881515 GCACGCGTTAAGGGGCTGGACGG No data
949048087_949048099 16 Left 949048087 2:241881454-241881476 CCTGGTGCGGAGGAGGCCGCTGT No data
Right 949048099 2:241881493-241881515 GCACGCGTTAAGGGGCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048099 Original CRISPR GCACGCGTTAAGGGGCTGGA CGG Intergenic