ID: 949048100

View in Genome Browser
Species Human (GRCh38)
Location 2:241881494-241881516
Sequence CACGCGTTAAGGGGCTGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048086_949048100 18 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048100 2:241881494-241881516 CACGCGTTAAGGGGCTGGACGGG No data
949048087_949048100 17 Left 949048087 2:241881454-241881476 CCTGGTGCGGAGGAGGCCGCTGT No data
Right 949048100 2:241881494-241881516 CACGCGTTAAGGGGCTGGACGGG No data
949048094_949048100 1 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048100 2:241881494-241881516 CACGCGTTAAGGGGCTGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048100 Original CRISPR CACGCGTTAAGGGGCTGGAC GGG Intergenic