ID: 949048101

View in Genome Browser
Species Human (GRCh38)
Location 2:241881495-241881517
Sequence ACGCGTTAAGGGGCTGGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048087_949048101 18 Left 949048087 2:241881454-241881476 CCTGGTGCGGAGGAGGCCGCTGT No data
Right 949048101 2:241881495-241881517 ACGCGTTAAGGGGCTGGACGGGG No data
949048086_949048101 19 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048101 2:241881495-241881517 ACGCGTTAAGGGGCTGGACGGGG No data
949048094_949048101 2 Left 949048094 2:241881470-241881492 CCGCTGTAGGTGGGCACGGGGCA No data
Right 949048101 2:241881495-241881517 ACGCGTTAAGGGGCTGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048101 Original CRISPR ACGCGTTAAGGGGCTGGACG GGG Intergenic