ID: 949048224

View in Genome Browser
Species Human (GRCh38)
Location 2:241881979-241882001
Sequence ACTTGGCTGGGCCCCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048224_949048229 1 Left 949048224 2:241881979-241882001 CCTTCACTGGGGCCCAGCCAAGT No data
Right 949048229 2:241882003-241882025 ACTGAATCCAGCCAGGAGCAAGG No data
949048224_949048233 12 Left 949048224 2:241881979-241882001 CCTTCACTGGGGCCCAGCCAAGT No data
Right 949048233 2:241882014-241882036 CCAGGAGCAAGGGCAGACGCTGG No data
949048224_949048230 2 Left 949048224 2:241881979-241882001 CCTTCACTGGGGCCCAGCCAAGT No data
Right 949048230 2:241882004-241882026 CTGAATCCAGCCAGGAGCAAGGG No data
949048224_949048228 -6 Left 949048224 2:241881979-241882001 CCTTCACTGGGGCCCAGCCAAGT No data
Right 949048228 2:241881996-241882018 CCAAGTAACTGAATCCAGCCAGG No data
949048224_949048234 18 Left 949048224 2:241881979-241882001 CCTTCACTGGGGCCCAGCCAAGT No data
Right 949048234 2:241882020-241882042 GCAAGGGCAGACGCTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048224 Original CRISPR ACTTGGCTGGGCCCCAGTGA AGG (reversed) Intergenic
No off target data available for this crispr