ID: 949048569

View in Genome Browser
Species Human (GRCh38)
Location 2:241884364-241884386
Sequence CTGTAGATGGAGTTGGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048562_949048569 7 Left 949048562 2:241884334-241884356 CCAACCTGTCTTTGTATCTTACG No data
Right 949048569 2:241884364-241884386 CTGTAGATGGAGTTGGGTCTTGG No data
949048564_949048569 3 Left 949048564 2:241884338-241884360 CCTGTCTTTGTATCTTACGTGGG No data
Right 949048569 2:241884364-241884386 CTGTAGATGGAGTTGGGTCTTGG No data
949048561_949048569 8 Left 949048561 2:241884333-241884355 CCCAACCTGTCTTTGTATCTTAC No data
Right 949048569 2:241884364-241884386 CTGTAGATGGAGTTGGGTCTTGG No data
949048560_949048569 18 Left 949048560 2:241884323-241884345 CCTTTAGACACCCAACCTGTCTT No data
Right 949048569 2:241884364-241884386 CTGTAGATGGAGTTGGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048569 Original CRISPR CTGTAGATGGAGTTGGGTCT TGG Intergenic
No off target data available for this crispr