ID: 949048907

View in Genome Browser
Species Human (GRCh38)
Location 2:241886521-241886543
Sequence GGGGCAGGTGGCAGACCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048902_949048907 -6 Left 949048902 2:241886504-241886526 CCTTGGGGAGTGCGGTGGGGGCA No data
Right 949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG No data
949048890_949048907 25 Left 949048890 2:241886473-241886495 CCTCGCTATGAATGAGTTTGTCA No data
Right 949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG No data
949048896_949048907 0 Left 949048896 2:241886498-241886520 CCTCCTCCTTGGGGAGTGCGGTG No data
Right 949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG No data
949048899_949048907 -3 Left 949048899 2:241886501-241886523 CCTCCTTGGGGAGTGCGGTGGGG No data
Right 949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048907 Original CRISPR GGGGCAGGTGGCAGACCTCG GGG Intergenic
No off target data available for this crispr