ID: 949049225

View in Genome Browser
Species Human (GRCh38)
Location 2:241888358-241888380
Sequence GCTCAGGTCAGGCTGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 491}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949049215_949049225 5 Left 949049215 2:241888330-241888352 CCCTTCTGCCCTCTCAGAGGCAG 0: 1
1: 0
2: 4
3: 37
4: 343
Right 949049225 2:241888358-241888380 GCTCAGGTCAGGCTGGAGGGTGG 0: 1
1: 0
2: 1
3: 55
4: 491
949049216_949049225 4 Left 949049216 2:241888331-241888353 CCTTCTGCCCTCTCAGAGGCAGC 0: 1
1: 0
2: 5
3: 60
4: 369
Right 949049225 2:241888358-241888380 GCTCAGGTCAGGCTGGAGGGTGG 0: 1
1: 0
2: 1
3: 55
4: 491
949049213_949049225 9 Left 949049213 2:241888326-241888348 CCGGCCCTTCTGCCCTCTCAGAG 0: 1
1: 1
2: 4
3: 54
4: 439
Right 949049225 2:241888358-241888380 GCTCAGGTCAGGCTGGAGGGTGG 0: 1
1: 0
2: 1
3: 55
4: 491
949049217_949049225 -3 Left 949049217 2:241888338-241888360 CCCTCTCAGAGGCAGCCACAGCT 0: 1
1: 1
2: 4
3: 44
4: 359
Right 949049225 2:241888358-241888380 GCTCAGGTCAGGCTGGAGGGTGG 0: 1
1: 0
2: 1
3: 55
4: 491
949049212_949049225 17 Left 949049212 2:241888318-241888340 CCTGCAGGCCGGCCCTTCTGCCC 0: 1
1: 0
2: 5
3: 26
4: 324
Right 949049225 2:241888358-241888380 GCTCAGGTCAGGCTGGAGGGTGG 0: 1
1: 0
2: 1
3: 55
4: 491
949049218_949049225 -4 Left 949049218 2:241888339-241888361 CCTCTCAGAGGCAGCCACAGCTC 0: 1
1: 0
2: 1
3: 33
4: 369
Right 949049225 2:241888358-241888380 GCTCAGGTCAGGCTGGAGGGTGG 0: 1
1: 0
2: 1
3: 55
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949049225 Original CRISPR GCTCAGGTCAGGCTGGAGGG TGG Intergenic
900386527 1:2413302-2413324 GCTCAGGCCAGGCAGGGTGGAGG - Intronic
900639259 1:3681089-3681111 GCACAGGCCAGGCTGAGGGGCGG - Intronic
901511740 1:9721095-9721117 GCCGAGGTCAGGCTTGGGGGCGG - Intronic
901610960 1:10497446-10497468 GCTCAGCTCAGGCCTGAGGATGG + Intronic
902170322 1:14604866-14604888 TCTCCAGTCAGGCTGGAGAGGGG + Intronic
902416521 1:16242967-16242989 CCTCAGGGCGGGCTGGAGGAGGG - Intergenic
902962884 1:19977217-19977239 GAGCAGGTCATGGTGGAGGGTGG - Intronic
903258961 1:22121049-22121071 GTTCAGGACAGGCCAGAGGGGGG - Intronic
903292510 1:22323650-22323672 GCTCAGGTTAGGGTGGGGGCAGG + Intergenic
903811368 1:26036679-26036701 GCCGAGGTCAAGCTGGGGGGTGG - Intergenic
903941980 1:26938212-26938234 GCCTAGGTCAGGCTGATGGGAGG + Intronic
904251007 1:29224284-29224306 GCTCCTGTCTGGCTGGAGGCTGG + Intronic
904786118 1:32984325-32984347 GCTCAGCTCAGCCAGAAGGGAGG + Intergenic
905463562 1:38136662-38136684 GCTAGGGTTGGGCTGGAGGGTGG + Intergenic
905542643 1:38772549-38772571 GGTCAGGTGAGGCTGTAGAGGGG - Intergenic
906544886 1:46613783-46613805 GCTGGGGGCAGGGTGGAGGGGGG + Intronic
906656533 1:47552368-47552390 GCACAGGGCAGGTTGGAGGAAGG - Intergenic
907414742 1:54306463-54306485 CCTCAGGTGAGGCTGCAGTGTGG - Intronic
907450348 1:54542275-54542297 GCTGCGGGCAGGCTGAAGGGAGG - Intronic
907487554 1:54788025-54788047 CATCAGGTCAGGCAAGAGGGTGG - Exonic
907762821 1:57378125-57378147 GCTCAGAGCAGGATGGAGGCAGG + Intronic
909429717 1:75573084-75573106 GCTCAGCTCAGGCTGGAGCGCGG - Intronic
910722007 1:90296573-90296595 GCCCTGCTCAGGCTGCAGGGTGG - Intergenic
911061379 1:93751093-93751115 GTTCTGGTCAGGATGAAGGGAGG - Intronic
911669173 1:100588827-100588849 GTTGAGGTCAGGGTGGAGGCAGG - Intergenic
912451058 1:109768123-109768145 GCCCAGGCCAGGGTGGTGGGAGG - Intronic
912468653 1:109891684-109891706 TCTCAGCTGAGGCTGGAGGGAGG + Intergenic
912823083 1:112882894-112882916 GCTAAGGCCAGGCTGCTGGGGGG - Intergenic
914986043 1:152457888-152457910 ACTGAGGTAGGGCTGGAGGGGGG + Intergenic
915166627 1:153951593-153951615 GCTCAGGGAAGCCTGGAGGTTGG + Exonic
915480101 1:156178586-156178608 GCTCAGGCGACACTGGAGGGAGG - Intergenic
915915181 1:159936646-159936668 GCAAAGGCCAGGCTGGAGGATGG - Intronic
917192201 1:172429964-172429986 TTACAGGTAAGGCTGGAGGGTGG - Intronic
920294463 1:204947349-204947371 GCCCAGGGCTGGATGGAGGGTGG - Intronic
920695101 1:208175768-208175790 GCAGAGGTCAGGCTGGAGAATGG + Intronic
920698193 1:208197872-208197894 GCAAAGGTGAGGCTGGAGGAAGG - Intronic
921029611 1:211326137-211326159 TCTCACGCCAGGCTGGAGTGCGG - Intergenic
922595537 1:226810090-226810112 GCCCAGCTCAGGGTGCAGGGAGG + Intergenic
923546518 1:234927487-234927509 GCTGAGGCCAGGCTGGGTGGAGG - Intergenic
1062939841 10:1412979-1413001 CCTCAGGGCTGGCGGGAGGGTGG + Intronic
1063361470 10:5462978-5463000 CCACATCTCAGGCTGGAGGGAGG - Intergenic
1063917830 10:10902761-10902783 GCTCAGGAAAGGAGGGAGGGAGG + Intergenic
1064220880 10:13439653-13439675 AATCAGCTCAGGCTGGAGGAGGG - Intronic
1065242110 10:23716614-23716636 GTTCAGTCCAGGCTGGAGGTGGG - Intronic
1065944335 10:30593319-30593341 GCTCAGGTCAGCAGGGAGTGTGG + Intergenic
1066055635 10:31677908-31677930 TCACAGGTCTGGCTGGAGGAGGG + Intergenic
1067040863 10:42952477-42952499 GCTCAGGACAGGGAGGAGGGTGG - Intergenic
1067151408 10:43737995-43738017 GTTCAGGCCAGGGTGGAGGCAGG + Intergenic
1067338355 10:45381675-45381697 ACTTAGCTCAGGCTGGAGGATGG - Intronic
1067459346 10:46445919-46445941 GTTCAGGCAAGGCAGGAGGGAGG + Intergenic
1067627848 10:47938711-47938733 GTTCAGGCAAGGCAGGAGGGAGG - Intergenic
1068720366 10:60238582-60238604 GCTGAGGTAAGGCAGGAGTGTGG + Intronic
1069752489 10:70753179-70753201 GCTCTGGTGAGGATGGAAGGAGG - Intronic
1069893169 10:71664507-71664529 GCACAGGACAGGCAGGTGGGAGG + Intronic
1071603496 10:86970262-86970284 GGTCTGGTGGGGCTGGAGGGAGG + Exonic
1071910385 10:90225259-90225281 GCTAAGTTCAGGCTGCAGTGAGG - Intergenic
1072102345 10:92240507-92240529 GAACAGGTCAGGCTGTTGGGTGG + Intronic
1072442745 10:95471414-95471436 GCTGAGGTTAGGGTGGAGGAGGG + Intronic
1072460188 10:95611583-95611605 AGTCAGATCATGCTGGAGGGAGG - Intronic
1072768410 10:98115391-98115413 GCTCAGGGCAAGCTGAAGGTGGG - Intergenic
1075004087 10:118818130-118818152 GCTCAGGTGGGGCTGGGGTGGGG + Intergenic
1075715276 10:124551835-124551857 GGTGAGGTCAGGCTGGAGCGAGG - Intronic
1076760636 10:132604245-132604267 GCACAGGGCAGGATGGAGAGGGG - Intronic
1076760646 10:132604277-132604299 GCACAGGGCAGGATGGAGAGGGG - Intronic
1076760664 10:132604341-132604363 GCACAGGGCAGGATGGAGAGGGG - Intronic
1077130746 11:971266-971288 GTTGAGCTGAGGCTGGAGGGAGG + Intronic
1077362225 11:2145792-2145814 GACCAGGGCAGGCTGGAGGCTGG + Intronic
1077478781 11:2803313-2803335 GCCCAGGTCAGCCTGGACGGTGG + Intronic
1077539258 11:3138995-3139017 GCTCAGGTGCCCCTGGAGGGCGG - Intronic
1077579443 11:3407510-3407532 GCTCAAGCCAGGCTGGGGGTTGG - Intergenic
1079089931 11:17473774-17473796 GTTCAGCGCAGGCTGGAGGCAGG - Intronic
1080640859 11:34157542-34157564 GCTCAGATCAGGCAGGAGGCAGG - Intronic
1082818714 11:57528907-57528929 GCACTGGTCATTCTGGAGGGAGG + Exonic
1083201913 11:61125847-61125869 GCTGGGGTCAGGCTGGAGACGGG - Intronic
1083212083 11:61194349-61194371 GCTCAGGTAAAGCTGTAGGCAGG - Intergenic
1083613845 11:64016889-64016911 GCCCAGGACAGGCTGCAGAGGGG + Intronic
1083681518 11:64353956-64353978 GGTCAGGACAGGGAGGAGGGAGG - Intronic
1083897988 11:65629829-65629851 GCTCTGTCCAGGCTGGCGGGTGG + Intronic
1083922696 11:65788973-65788995 ACACAGGTGAGGGTGGAGGGCGG - Intronic
1083991689 11:66250043-66250065 GGTCAGGTGTGGCTCGAGGGTGG - Intergenic
1084156762 11:67317494-67317516 GCTCAGCCCAGGCTGGGGCGGGG + Intergenic
1084428413 11:69097954-69097976 GCTCAGGGCCACCTGGAGGGTGG - Intergenic
1084457836 11:69278577-69278599 GTTCAGCTCAGGCTGGAGTGTGG + Intergenic
1084835946 11:71801942-71801964 GCTCAAGCCAGGCTGGGGGTTGG + Intergenic
1085141727 11:74150449-74150471 GCCCAGCCCAGGCTGGAGTGCGG - Intronic
1085312131 11:75522971-75522993 GCTCAGCTCAGGCTGCTGTGTGG - Intronic
1089135031 11:116242177-116242199 GCTCAGGGAAGGCTGGAGCGAGG - Intergenic
1089303808 11:117514444-117514466 GGAAAGGACAGGCTGGAGGGAGG - Intronic
1089390116 11:118095870-118095892 GGGCAGGACAGGCTGGAGGGAGG + Intronic
1089499043 11:118922167-118922189 GGTCAGGCCAGGCTGGGGGTGGG + Intronic
1089534033 11:119149748-119149770 GCTGGGGTCAGGCTGGAGCTGGG + Intronic
1089626613 11:119755056-119755078 GCTGAGGTGAGGCTGGCGTGAGG + Intergenic
1090047137 11:123345809-123345831 GCTCTGGTCAGAGTGGTGGGGGG - Intergenic
1090305658 11:125688893-125688915 GCTCAGGTTAGGGTGGGGAGCGG - Intergenic
1090421324 11:126577306-126577328 GCTCAGGTCAGGTCGATGGGTGG + Intronic
1090427153 11:126615924-126615946 GGACAGGACAGGATGGAGGGAGG + Intronic
1091284226 11:134399174-134399196 GGTGAGGTGAGGCTGGAGGCGGG - Intronic
1091304358 11:134528075-134528097 GGTCAGGCCAGGCAGGAGCGGGG - Intergenic
1091622818 12:2102025-2102047 GCCCAGGGCAGCCTGGAGTGTGG - Intronic
1091677710 12:2503490-2503512 GCTCACCACTGGCTGGAGGGTGG - Intronic
1091691032 12:2597701-2597723 GCTTAGGGGTGGCTGGAGGGAGG - Intronic
1091995120 12:4987290-4987312 GCTCAGGGAAGGATGGAAGGTGG - Intergenic
1092407377 12:8230461-8230483 GCTCAAGCCAGGCTGGGGGTTGG - Intergenic
1095818967 12:46455999-46456021 GCTCAAGTCAGGCTTGGGAGAGG + Intergenic
1096100259 12:48966472-48966494 GTTCAAGACATGCTGGAGGGCGG - Exonic
1096460190 12:51818148-51818170 GCTCTGGTAATGCTGGGGGGAGG - Intergenic
1096756793 12:53806267-53806289 GCTTGGGTCAGTCTGGAGGCAGG - Intergenic
1096790208 12:54039735-54039757 GCCCTGGGGAGGCTGGAGGGTGG - Intronic
1096814891 12:54195842-54195864 GCTCAGCTCAGGGTGGGAGGGGG - Intergenic
1097192371 12:57225750-57225772 GCTCAGGACTGGCTGGGGAGGGG - Exonic
1097590353 12:61566996-61567018 GCTCAGGTCATGATGGAAGGAGG + Intergenic
1102461680 12:113103929-113103951 GCTCAGGTGAGGGGGCAGGGCGG - Exonic
1102799278 12:115717513-115717535 GCTGAGATCAGGATGGATGGTGG - Intergenic
1103432233 12:120898265-120898287 GCTCTGTCCAGGCTGGAGTGTGG - Intronic
1103437061 12:120935055-120935077 GCTCTGTTCAGGCTGGAGTGCGG + Intergenic
1103906452 12:124330102-124330124 GCTGAGGCCAGGATGGAGGTCGG - Intronic
1104273695 12:127305412-127305434 GGTCAGGGCAGGGAGGAGGGAGG + Intergenic
1104729694 12:131098037-131098059 GCCCAGGTGAGGCTGGCGCGGGG - Intronic
1104753234 12:131253009-131253031 GCTGAGGACAGGCAGGAGGAAGG - Intergenic
1104774038 12:131381968-131381990 TCTCAGGACAGGCTGGCTGGGGG - Intergenic
1104910618 12:132238519-132238541 GCCCAGGACAGGCCAGAGGGCGG + Intronic
1105896355 13:24719901-24719923 GCTGAGCTCAGGCTGGGGGCGGG + Intergenic
1106178070 13:27348216-27348238 GCTGAGGTGAGGTGGGAGGGTGG - Intergenic
1106183367 13:27386941-27386963 GCACAGGAGAGACTGGAGGGAGG + Intergenic
1106464898 13:30004735-30004757 GCTGAGATCTGGATGGAGGGAGG - Intergenic
1110616186 13:77544614-77544636 GCTCAGATTGGGCTGGTGGGAGG + Intronic
1112339961 13:98544590-98544612 CCTCAGGTCGGCTTGGAGGGTGG - Intronic
1112793500 13:103029615-103029637 GCAGAGGTCAGCCTGGAGGATGG + Intergenic
1113876293 13:113596928-113596950 GCTCAGGACAGGCTGGGGCGAGG - Intronic
1113935562 13:113993210-113993232 GCACACGTCAGGCTGGAGCGCGG + Intronic
1113958607 13:114112918-114112940 GCTCAGGGAGGGCTGGAGGGTGG + Intronic
1114627391 14:24138409-24138431 GCCCAGGTCAGGGTGCATGGGGG + Intronic
1115475327 14:33807947-33807969 GATCAGGTCATGCTGGAGTAGGG - Intergenic
1117911008 14:60638011-60638033 GCCCAGCACAGGCTGGGGGGAGG - Intergenic
1119484355 14:74978283-74978305 GTGCAGGCCAGGCTGGAGGCGGG + Intergenic
1119893117 14:78197792-78197814 GCTCAGATCAGGGAGGAGAGGGG + Intergenic
1121136095 14:91500235-91500257 ACTCTTGTCAGGCTGGAGTGCGG + Intronic
1122072087 14:99211389-99211411 GCACAGGCCAGGATGGAGTGAGG - Intronic
1122780324 14:104140749-104140771 GCTCAGGGGAGGCTGGAGATGGG - Intronic
1122903181 14:104790355-104790377 GCTCAGGCCTGGCTGGGGGTGGG - Intronic
1122953402 14:105058750-105058772 GCTCAGGGCATGCAGGGGGGTGG + Intronic
1123025372 14:105421374-105421396 CCTCATGTCAGGCTGGAAGGGGG - Intronic
1123107147 14:105847036-105847058 GATGAGGTCACGCTGGAGGCAGG + Intergenic
1123126030 14:105946876-105946898 GCACAGCCCAGGCTGCAGGGTGG + Intergenic
1202902004 14_GL000194v1_random:49577-49599 GTGCAGGGCAGGGTGGAGGGAGG + Intergenic
1123406616 15:20023298-20023320 GCACAGCCCAGGCTGCAGGGTGG + Intergenic
1123515946 15:21029946-21029968 GCACAGCCCAGGCTGCAGGGTGG + Intergenic
1124155017 15:27218094-27218116 GATCACTTGAGGCTGGAGGGTGG - Intronic
1124379841 15:29156038-29156060 GCACAGGTGGGGCTGGAGGGAGG + Intronic
1124879555 15:33628589-33628611 GGCCAGGTTAGGGTGGAGGGTGG + Intronic
1124952514 15:34337218-34337240 CCACAGGTCTGGCTGGGGGGAGG + Intronic
1125375478 15:39024354-39024376 CCTAAGGTAAGGCTGGAGGAAGG + Intergenic
1125832301 15:42725616-42725638 GCACAGTACAGGCTGGAGAGAGG - Exonic
1126118301 15:45228759-45228781 GTTTTGATCAGGCTGGAGGGAGG + Intergenic
1127364681 15:58276830-58276852 GCTCTGGTTAGGCTGGATGAGGG + Intronic
1127762238 15:62150581-62150603 GATCAGGTGAGGCTGGTTGGAGG - Intergenic
1128255217 15:66191234-66191256 TCTGAGCTCGGGCTGGAGGGAGG + Intronic
1128432635 15:67612704-67612726 GCTTTTGTCAGGCTGGAGAGAGG - Intronic
1129172196 15:73815030-73815052 GCTCAGGCCAGGCTGGTGGATGG + Intergenic
1129201761 15:74006755-74006777 CCTCAGGTGAGGCTGCAGGTAGG + Intronic
1129296627 15:74603580-74603602 CCTGAGATCAGGCTGGATGGAGG - Intronic
1129525205 15:76209262-76209284 GCCCAGGGCTGGCTGGAGAGGGG - Intronic
1129677552 15:77640605-77640627 GGACAGGTCAGAATGGAGGGAGG - Intronic
1130327894 15:82896165-82896187 GTTCTGGTCAGGAAGGAGGGTGG + Intronic
1130609599 15:85348873-85348895 GTCCAGGTCAGGCTGGAGTCAGG - Intergenic
1131399090 15:92110309-92110331 GCCCAGGGCATGCTGGAGTGTGG - Intronic
1132555394 16:569890-569912 GCTCGGGTCGGGCGGGCGGGCGG + Intronic
1132563502 16:609833-609855 GCGCGGCTCAGGATGGAGGGCGG + Intronic
1132669750 16:1097755-1097777 GCACAGAGCAGGGTGGAGGGAGG + Intergenic
1132810089 16:1793218-1793240 GCTCAGCTCAGGCTTGGGGGTGG + Intronic
1133014754 16:2934186-2934208 GGGCAGGTCAGGCTGGAAGGGGG - Intronic
1133203989 16:4221955-4221977 GATGAGGTCATGCTGGAGTGGGG - Intronic
1133333588 16:4991785-4991807 GCACGGGGCAGGATGGAGGGGGG - Intronic
1133348062 16:5083570-5083592 GCTCAAGCCAGGCTGGGGGTTGG - Intronic
1134133126 16:11663267-11663289 GCTGAGGGCAGGCTGGGGGCAGG + Intergenic
1134250203 16:12568922-12568944 GTTCAGGGCTGGCAGGAGGGTGG + Exonic
1134680277 16:16120199-16120221 GCCCAGGGCAGGATGCAGGGAGG + Intronic
1135196973 16:20402847-20402869 GGTCAGGGCAGGCTGCAGGCAGG - Intronic
1135237463 16:20771096-20771118 GCTCTTTTCAGGCTGGAGTGCGG + Intronic
1135780066 16:25292466-25292488 TCACAGCTCAGGCTGGAGTGTGG + Intergenic
1136028822 16:27488139-27488161 GCTCAGGCCTGGCTGGAGTGAGG + Intronic
1136041097 16:27579574-27579596 CCTCAAGTCTGGCTGGAGTGAGG - Intronic
1136147343 16:28323121-28323143 TCTGGGGTCAGGCTGGAGGCTGG - Exonic
1137496263 16:48971587-48971609 GATCAGGGCTGGCAGGAGGGAGG - Intergenic
1137595345 16:49719987-49720009 TCTCAGGCCAGGCTGGAGAGAGG - Intronic
1138530660 16:57632632-57632654 GCACGAGTCAGGCTGGAGGTGGG - Intronic
1139378546 16:66515907-66515929 GCTCAGGATAGGCTGGACTGGGG - Intronic
1139380752 16:66529268-66529290 GGGCAGGTCAGGGTGGAAGGGGG - Intronic
1139484538 16:67248459-67248481 GCTCAGGTCCGGGTGGGGGCCGG + Intronic
1139667849 16:68470871-68470893 GCTCTTGTCAGGCTGCATGGGGG - Intergenic
1139780039 16:69343678-69343700 GCTCAGGTGAGGCTAGATGGGGG - Intronic
1140479947 16:75257032-75257054 GCTCAGTCCTGGCTGGAAGGGGG + Intronic
1140843127 16:78860797-78860819 GCTTAGCTCAGGCTATAGGGAGG + Intronic
1141206092 16:81934154-81934176 GGTGAGGTCAGGATGGAAGGGGG - Intronic
1141571193 16:84934548-84934570 GGTCTGGGCTGGCTGGAGGGAGG - Intergenic
1141722641 16:85765317-85765339 CCTCAGCTGAGGATGGAGGGTGG + Intergenic
1142125695 16:88409182-88409204 GCTCAGGTCAGCATTCAGGGAGG + Intergenic
1142197445 16:88745320-88745342 GTTCAGGAAAGGCTGAAGGGCGG - Intronic
1142227402 16:88884323-88884345 CCCCAGGACAGGCTGCAGGGAGG - Intronic
1142352249 16:89585820-89585842 GGTCAGGTGGGGGTGGAGGGGGG + Intronic
1143025768 17:3941295-3941317 GGTCAGGTCCGTCTGTAGGGAGG + Exonic
1143104133 17:4519961-4519983 GCTCAGGACAGACAGGAGGGAGG - Intronic
1143300026 17:5902220-5902242 GCACAAGTCAGGCTGCAGGAGGG + Intronic
1143329371 17:6122084-6122106 GCTTGGCTCAGGCTGAAGGGAGG - Exonic
1143426447 17:6843021-6843043 GCTGGGGTGAGGCTGGATGGGGG + Intergenic
1143726388 17:8849765-8849787 GCTCAGGTCAGTGTGGTGGGGGG - Exonic
1144711871 17:17406457-17406479 GCTGAGGCTGGGCTGGAGGGAGG + Intergenic
1144768744 17:17747298-17747320 GCTCAGGGCTGGCTGGAGAAGGG - Intronic
1144816541 17:18039366-18039388 GCTCAGGCGAGCCTGGGGGGCGG - Exonic
1145714148 17:27003695-27003717 GCTTACCTGAGGCTGGAGGGTGG - Intergenic
1145751386 17:27357387-27357409 GGTCAGCTCAGGCTGGCTGGTGG - Intergenic
1147334147 17:39716621-39716643 GCTCAGAGCTGGGTGGAGGGGGG + Intronic
1150652720 17:67020247-67020269 GCCCAGGGCAGGATGGAGTGAGG + Intronic
1151242688 17:72770460-72770482 CATTAGGTCAGGCTGAAGGGAGG - Intronic
1151578361 17:74963929-74963951 GCAGAGGGCAGGCTGGAAGGTGG + Intronic
1151923851 17:77178884-77178906 GTTCAGCATAGGCTGGAGGGTGG + Intronic
1151928781 17:77217685-77217707 GCTCAGGGCAGGCCAGAAGGCGG + Intergenic
1152027664 17:77822311-77822333 TCTCAGGTCAGGATGGAGATTGG - Intergenic
1152040546 17:77899944-77899966 CCTCAGGCAGGGCTGGAGGGTGG - Intergenic
1152205929 17:78974376-78974398 TTTCAGGTCAGGCTGGAGCCAGG + Intronic
1152261366 17:79269040-79269062 GATCAGGTCAGACTGGACTGGGG + Intronic
1152554006 17:81044113-81044135 CCTCAGGTCAGGCAGGTGGGAGG - Intronic
1152630955 17:81410512-81410534 CCCCAGGACATGCTGGAGGGTGG - Intronic
1153977157 18:10279675-10279697 GCTGAGGAGAGGCTGGAAGGTGG + Intergenic
1156456137 18:37295517-37295539 GCTCAGAGCATGCTGGAGGCAGG + Intronic
1156491744 18:37500411-37500433 GCTAAGGTCAGGCTGCAGGCTGG - Intronic
1157280100 18:46341306-46341328 GCTGAGGTCAGGGAGGGGGGTGG + Intronic
1157369525 18:47097881-47097903 TCTCCAGTCAGGGTGGAGGGTGG - Intronic
1157595572 18:48861636-48861658 GCTCAGGTCAGGGAGGAGGCAGG + Exonic
1158515495 18:58127121-58127143 GCTCTGGTCCGCCAGGAGGGAGG - Intronic
1158572900 18:58611912-58611934 GCTCACTGCACGCTGGAGGGTGG + Intronic
1158941176 18:62406807-62406829 GCTCAGGTCCAACTAGAGGGAGG - Intergenic
1160547811 18:79672669-79672691 GGTGAGGGCAGGCTGGCGGGTGG - Intergenic
1160837353 19:1131204-1131226 GCTGAGCTGAGGCTGGAGGGTGG - Intronic
1160861424 19:1238647-1238669 GCTCGGGCCAGGCTGGTGGCAGG - Intergenic
1161330482 19:3684501-3684523 GCTGGGGCCAGGCTGGAGGGTGG + Intronic
1161983136 19:7640889-7640911 GCTCGGGGCAGGCTGGGGTGAGG - Exonic
1162403842 19:10461818-10461840 GCCCGGGTCAGTCTGGGGGGCGG + Intronic
1162502143 19:11060089-11060111 GCACAGGACCGGCTGAAGGGCGG + Exonic
1162727045 19:12696107-12696129 GCCCAGGTCAGGCTTGGGGCGGG - Intronic
1162760650 19:12886338-12886360 GATCAGGTCTGGCTGGAGACAGG + Intronic
1163250335 19:16122970-16122992 GGTCAGGGCAGGGTGGAAGGTGG - Intronic
1163665927 19:18604123-18604145 GCCCAGGCCAAGCTGGCGGGTGG - Intronic
1163738681 19:18997326-18997348 CCTCAGGTCAGGAGGGAGGGAGG + Intronic
1163831628 19:19549805-19549827 GGTCTGGGCAGGCAGGAGGGAGG + Intergenic
1164051344 19:21587355-21587377 GGGCAGGGCAAGCTGGAGGGGGG + Intergenic
1164630734 19:29760070-29760092 GCACAGGCCAGGCTGGAGAAAGG - Intergenic
1165062750 19:33212784-33212806 GCTCAGGGCAGGATGGAGCCCGG + Intronic
1166010183 19:39935703-39935725 GCGCAGGCCAGGCTGCAGGTGGG + Intergenic
1166301329 19:41913497-41913519 GCCCAGGACGGGCTGCAGGGGGG + Intronic
1166356616 19:42230856-42230878 TCTCAGTTAAAGCTGGAGGGAGG + Exonic
1166383652 19:42368758-42368780 GCTCAGAGGAGGCAGGAGGGAGG + Intronic
1166427516 19:42692706-42692728 GTGGAGGTCAGGCTGGAGGTGGG + Intronic
1166975964 19:46605194-46605216 ACTCTGGTCAGGCTGGAGGCAGG - Intronic
1167289950 19:48619058-48619080 GCTAGGGGCACGCTGGAGGGCGG - Intronic
1167890402 19:52535545-52535567 GCTCAGGCCAGGGAGGAGTGAGG - Intronic
1167906537 19:52665217-52665239 GCTCAGGCCAGGGAGGAGTGAGG + Intronic
1167909623 19:52690931-52690953 GCTCAGGCCAGGGAGGAGTGAGG + Intergenic
1167914128 19:52726201-52726223 GCTCAGGCCAGGGAGGAGTGAGG + Intronic
1167921646 19:52787198-52787220 GCTCAGGCCAGGGAGGAGTGAGG + Intronic
1167930320 19:52858059-52858081 GCTCAGGCCAGGGAGGAGTGAGG + Intergenic
1167940628 19:52943039-52943061 GCTCAGGCCAGGGAGGAGTGAGG + Intronic
1167946715 19:52994039-52994061 GCTCAGGCCAGGGAGGAGTGAGG + Intergenic
1167987744 19:53333282-53333304 GCTCAGGCCAGGGAGGAGTGAGG - Intergenic
1168003415 19:53467288-53467310 GCTCAGGCCAGGGAGGAGTGAGG - Intergenic
1168072227 19:53959615-53959637 GCTGAGGTCAGGCTGGGGCTGGG - Intergenic
925121816 2:1424411-1424433 GGTCAGGTCACGATGGAAGGTGG - Intronic
925274436 2:2638670-2638692 GCTCTGGCCAGGCAGGAGGCGGG + Intergenic
925832942 2:7914137-7914159 GCTGAGGGTAGGCTGGAGCGGGG - Intergenic
925898754 2:8493889-8493911 GCTCAGGTCAGAGAGGAGGAAGG - Intergenic
925972762 2:9118576-9118598 GCCGAGGTCATGGTGGAGGGAGG + Intergenic
926889474 2:17626881-17626903 GGTCAGGCCAGGCTGGAGTGGGG - Intronic
927157754 2:20231386-20231408 GCGAAGGGCAGGCTGCAGGGAGG + Intergenic
927209364 2:20629380-20629402 GCAGAGGGCGGGCTGGAGGGCGG - Intronic
927870140 2:26618143-26618165 GATGAGGTCGGGGTGGAGGGAGG - Intronic
928792488 2:34974790-34974812 GCTTAGCTGAGGGTGGAGGGTGG - Intergenic
929564037 2:42973883-42973905 ACTCAGGGCAGGATGGGGGGCGG - Intergenic
930025530 2:47027066-47027088 ACTTACGGCAGGCTGGAGGGTGG - Intronic
932584690 2:73020374-73020396 GCTCAGGTCAGTTAGGCGGGAGG + Intronic
932732048 2:74228222-74228244 CCTCAGCTGAGGCTGGAGGTAGG - Intronic
932798107 2:74715405-74715427 GCTCAGGGCAGGCCGGGGCGGGG + Intergenic
934553753 2:95276942-95276964 GCACAGGGCAGTCTGCAGGGTGG - Intronic
936079046 2:109419685-109419707 GGTCAGCCCAGGCAGGAGGGAGG - Intronic
936389193 2:112055926-112055948 GCCCAGGTCGGGCCGGAGGAGGG - Intronic
936518515 2:113197681-113197703 GCCCAGAACAGTCTGGAGGGTGG + Intronic
937041234 2:118822276-118822298 GCCGAGGTGAGGCTGCAGGGAGG - Intergenic
937882696 2:126880438-126880460 GCTCAGGTGAGGTGGGAGGTGGG + Intergenic
937955905 2:127421713-127421735 GCTCAGCAGTGGCTGGAGGGTGG - Intronic
938702679 2:133893341-133893363 GGTGAGGTCTGGATGGAGGGAGG - Intergenic
939752372 2:146063797-146063819 CATCAGGGCAGCCTGGAGGGAGG - Intergenic
941463149 2:165794308-165794330 GCTCAGGTAGGGCTGGGGCGGGG - Exonic
941642894 2:168008189-168008211 GATGAGGACAGGCTGAAGGGAGG + Intronic
943974648 2:194458232-194458254 GCTCTGGCAAGGCTGGAGTGTGG - Intergenic
944677847 2:202049105-202049127 ACTCAGCTGAGGCTGGAGGATGG + Intergenic
945264969 2:207881913-207881935 CCTAAGGGCAGGCAGGAGGGAGG - Intronic
945482931 2:210363883-210363905 GCTGAGGTCTTGCTGCAGGGAGG - Intergenic
945992426 2:216407287-216407309 GCACAGGCCAGGCTGGAATGAGG - Intergenic
946026237 2:216673440-216673462 GGTCAGGGCAGGCTGGAGGAAGG + Exonic
947957475 2:234205774-234205796 GCACATGTCATGTTGGAGGGGGG + Intergenic
947963584 2:234260125-234260147 GCTGAGGTGAGGCTGAAGTGAGG - Intergenic
947982913 2:234425548-234425570 GCACGGGTGAGGCTGGTGGGTGG + Intergenic
948220017 2:236262294-236262316 GCTCAGGGCATGCTGAAGGCAGG + Intronic
948653783 2:239464600-239464622 GGTCAGGTCAGGCAGCATGGTGG + Intergenic
948988573 2:241540620-241540642 GATGAGGTCACTCTGGAGGGTGG + Intergenic
949043232 2:241858908-241858930 TCCCAGGTCAGGTTGAAGGGAGG + Exonic
949049225 2:241888358-241888380 GCTCAGGTCAGGCTGGAGGGTGG + Intergenic
1168998697 20:2151048-2151070 GCTCAGGTCAGGCAACAGGGTGG - Intronic
1169132247 20:3172439-3172461 GCTCAGGTCAGGGTAGATAGAGG - Intronic
1169248966 20:4045889-4045911 GCTGAGGCCAGGCTGGACTGAGG + Intergenic
1170855624 20:20051641-20051663 GCTCAAGAAAGACTGGAGGGAGG + Intronic
1171014474 20:21527623-21527645 GCTCAAGGCAGTCTAGAGGGTGG + Intergenic
1171065210 20:22008498-22008520 GCTGAGGTCAGGATGGAATGGGG - Intergenic
1171190080 20:23152554-23152576 CAGCAGGTCAGGCTGGAGAGTGG - Intergenic
1171406755 20:24916971-24916993 GCTCAGGAGAAGCTGGAAGGGGG - Intergenic
1173354927 20:42278437-42278459 GCTTAGAGGAGGCTGGAGGGAGG + Intronic
1173624461 20:44462087-44462109 GCTGAAGACAGGCAGGAGGGTGG + Exonic
1173998700 20:47358809-47358831 GCTGAGGCCAAGCTGCAGGGAGG + Intergenic
1174183973 20:48692644-48692666 GCTCAGGCAAGGCTGGGGGAGGG + Intronic
1174263744 20:49316684-49316706 CCTGGGGTTAGGCTGGAGGGAGG - Intergenic
1174394022 20:50234809-50234831 GCTCAGGTGAGGCTGGATCAAGG + Intergenic
1174452995 20:50631188-50631210 GCTCAGGGAGGGCTGGAGGAGGG - Intronic
1175236963 20:57520876-57520898 GCTGAGGTCATGCTGGATGAAGG + Intronic
1175689695 20:61056554-61056576 GCTCAAGGCAGCCTGGTGGGTGG + Intergenic
1175696469 20:61106489-61106511 GCTCAGGGAAGGGTGGAAGGGGG - Intergenic
1176000217 20:62828301-62828323 GCTCAGGTCTGGGCTGAGGGTGG - Intronic
1176113720 20:63422147-63422169 GCCCAGGTCAGGCAGCAGAGGGG + Intronic
1176128565 20:63486849-63486871 GGTGAGGTCAGGGTGGAGGATGG - Intergenic
1176239095 20:64067728-64067750 GGCCAGGACAGGCAGGAGGGTGG + Intronic
1176268593 20:64223636-64223658 CTTCAGGAGAGGCTGGAGGGTGG - Intronic
1176378648 21:6100635-6100657 GCCCAGGCCAGGCTGCAGGTGGG + Intergenic
1176429309 21:6566436-6566458 GGGCAGGTCCTGCTGGAGGGAGG - Intergenic
1176621373 21:9064344-9064366 GTGCAGGGCAGGGTGGAGGGAGG + Intergenic
1177797236 21:25791859-25791881 GCTTAGTTGAGGGTGGAGGGTGG - Intergenic
1177993837 21:28071604-28071626 CCACAGATCAGGGTGGAGGGTGG + Intergenic
1178442736 21:32612088-32612110 GCTCAGGTGCGGCTCGCGGGTGG - Exonic
1179217082 21:39376830-39376852 TCTCAGGTCAGGCTGAGGTGGGG + Intergenic
1179486527 21:41714079-41714101 GCTCATTCCACGCTGGAGGGAGG - Intergenic
1179504554 21:41831839-41831861 GCTGAGGTCACGCTGCAGGTGGG - Intronic
1179704701 21:43173898-43173920 GGGCAGGTCCTGCTGGAGGGAGG - Intergenic
1179744827 21:43437602-43437624 GCCCAGGCCAGGCTGCAGGTGGG - Intergenic
1180005916 21:45020475-45020497 GCTCAGGTCAGGCTCTGTGGAGG - Intergenic
1180060809 21:45383953-45383975 GCTCAGCCCTGGCTGCAGGGAGG - Intergenic
1180248344 21:46563214-46563236 GCTCAGGGCAGGCAAGAGGAGGG - Intronic
1180835732 22:18928617-18928639 GCCCAGGGCTGGCTGGAGGCAGG - Intronic
1180953954 22:19733145-19733167 GCTCAGCTCAGCCTGTAGGAGGG + Intergenic
1180988057 22:19917229-19917251 GCCCAGGGCAGGGAGGAGGGAGG + Intronic
1181401709 22:22653702-22653724 GGTCAGGAGGGGCTGGAGGGGGG - Intergenic
1181412546 22:22734470-22734492 GCCCAGGTGAGGGTGGAGTGAGG + Intergenic
1182019213 22:27066815-27066837 GGTCAAGAGAGGCTGGAGGGTGG - Intergenic
1182130494 22:27846784-27846806 TCCCAAGTGAGGCTGGAGGGAGG - Intergenic
1182280249 22:29214289-29214311 GCTCGGGTCAGGGTGGAGATGGG + Intronic
1182451264 22:30423346-30423368 GCTCAGGTCAGTCAGGAAGCGGG - Exonic
1183354887 22:37352893-37352915 GCACAGGTCGGGGTGGAGGATGG + Intergenic
1183362216 22:37388653-37388675 GCCCAACTGAGGCTGGAGGGAGG - Intronic
1183723350 22:39574854-39574876 GCTCAGGACAGGCTGTCTGGGGG - Intronic
1184038065 22:41927904-41927926 GCTCACGTCATCCTGGAAGGTGG + Intergenic
1184686095 22:46097019-46097041 CCTCAAGTCAGGCTGGCAGGCGG - Intronic
1184783221 22:46659355-46659377 GCTAAGTGGAGGCTGGAGGGAGG - Intronic
1184796812 22:46737842-46737864 GGTCGGGGCAGGCGGGAGGGAGG - Intronic
1184989141 22:48155512-48155534 ACTCATCTCAGGCTGAAGGGGGG + Intergenic
1185204296 22:49528888-49528910 GGGCAGGTGAGTCTGGAGGGGGG + Intronic
1185204320 22:49528978-49529000 GGGCAGGTGAGTCTGGAGGGGGG + Intronic
1185204345 22:49529068-49529090 GGGCAGGTGAGTCTGGAGGGGGG + Intronic
1185204392 22:49529248-49529270 GGGCAGGTGAGTCTGGAGGGGGG + Intronic
1185400260 22:50611841-50611863 GCTCAGGTCAGTGTGTAGTGGGG + Intronic
1203285821 22_KI270734v1_random:153916-153938 GCCCAGGGCTGGCTGGAGGCAGG - Intergenic
949388718 3:3535761-3535783 GATCAGGTCATGCTGGAGTAGGG - Intergenic
949499656 3:4667544-4667566 GCCCAGGTGAGGCGGGAGTGGGG + Exonic
949529027 3:4935439-4935461 GCACCAGACAGGCTGGAGGGAGG - Intergenic
949960331 3:9306757-9306779 GCTCAGGTCAGGTTTAAGAGAGG - Intronic
950261702 3:11546844-11546866 GCTCAGGTCAGGCTGACCAGAGG + Intronic
950523437 3:13509592-13509614 CCTCAGCTCAGGGTGGAGAGTGG + Intergenic
950578866 3:13850182-13850204 GGCCAGGCCAGGCTGGAAGGAGG - Intronic
951187869 3:19735284-19735306 GCTCCGGTTTGGCTGGAGAGTGG - Intergenic
952402340 3:32974744-32974766 GCTCAAGTCAGTCAGGAAGGAGG + Intergenic
953136824 3:40188978-40189000 GCTCAGGTCTGCCTGGAGCATGG - Intronic
953385712 3:42504634-42504656 GGTGAGGGCAGGCTGGAGTGAGG + Intronic
953865618 3:46580663-46580685 GCTCAGGCTAGGGTGGAGAGAGG - Intronic
954104185 3:48400342-48400364 TCTCAGCTCAGGCTGGAGTGTGG + Intronic
954104189 3:48400373-48400395 TCTCAGCTCAGGCTGGAGTGTGG + Intronic
954615798 3:51968049-51968071 GCGCAGGACAGGCTGGAGGAGGG + Intronic
954648424 3:52145248-52145270 GCTCATGTCAGGCTCCAGGTGGG - Intronic
957052418 3:75420834-75420856 GCTCAAGCCAGGCTGGGGGTTGG - Intergenic
959108349 3:102092097-102092119 GCTCAGAGCAGGGTGCAGGGTGG + Intergenic
961460161 3:127045122-127045144 GCTCAGGTGCAGGTGGAGGGTGG + Intergenic
961886040 3:130097065-130097087 GCTCAAGCCAGGCTGGGGGTTGG - Intronic
962682497 3:137814855-137814877 GCACAGGTCAGGCTGGTCAGAGG - Intergenic
964071208 3:152635335-152635357 GATCAGTTGAGGCTGCAGGGAGG + Intergenic
965615322 3:170586293-170586315 TCTTATGTCAGGCTGCAGGGAGG + Intronic
966938658 3:184731191-184731213 GCACAGAGCAGGCTGGAGAGTGG + Intergenic
967028782 3:185586644-185586666 GCTCCCGCCAGGCTGTAGGGAGG + Intronic
968131731 3:196196238-196196260 GCCCAGGTCAGTCTCGAAGGTGG + Intergenic
968606539 4:1538227-1538249 GCACTGGTGAGGCTGGGGGGAGG - Intergenic
968782641 4:2594614-2594636 CCTGAGGAGAGGCTGGAGGGAGG - Intronic
968869432 4:3234175-3234197 GCACAGTTCAGACAGGAGGGAGG + Intronic
968897441 4:3412967-3412989 GCTCACGTCAGGAGGGACGGGGG + Intronic
968897474 4:3413072-3413094 GCTCACGTCAGGAGGGACGGGGG + Intronic
968962817 4:3753784-3753806 GCTTAGGGCTGGCTGGTGGGGGG + Intergenic
968977561 4:3829950-3829972 GCACAGGTGTGGCTGGAGGTGGG + Intergenic
969579214 4:8054359-8054381 GCTCAGGGCCGCTTGGAGGGTGG - Intronic
969618357 4:8266623-8266645 GCTCTGCTCAGGCTGATGGGTGG - Intergenic
969758766 4:9167584-9167606 GCTCAAGCCAGGCTGGGGGTTGG + Intergenic
969818732 4:9705047-9705069 GCTCAAGCCAGGCTGGGGGTTGG + Intergenic
973336556 4:48962541-48962563 GTTCAGGTCATGATGGAAGGGGG - Intergenic
973916154 4:55636435-55636457 GCTCGGGTCCTGCTGCAGGGTGG - Intronic
975144114 4:70948879-70948901 GCTCAGAGCATGGTGGAGGGAGG - Intronic
979190001 4:117845107-117845129 GCCCAGGTCAGGCTGAAGTGAGG - Intergenic
979335286 4:119455107-119455129 GCTCAGGTGAGGCGAGTGGGCGG - Intergenic
981315480 4:143336484-143336506 TCGCAGGTCAAGCCGGAGGGTGG - Intergenic
983548974 4:168995039-168995061 CCTCAGGCCAGGCTGCATGGTGG - Intronic
984282485 4:177688236-177688258 GATCAAGGCAGGCTGGAGTGAGG + Intergenic
985651017 5:1107599-1107621 GCTCAGGCCTGGGTGCAGGGCGG - Intronic
985823377 5:2176056-2176078 GCTCAGGGCAGTGTGGAGGGAGG - Intergenic
986016897 5:3765597-3765619 GCTCAGAGCAGAGTGGAGGGTGG + Intergenic
986198101 5:5556401-5556423 GCTCAGGTCAAGCTGGGAGCCGG - Intergenic
986254083 5:6087294-6087316 GGTCAGCTCAGGCTGGATGGTGG - Intergenic
991589186 5:68231294-68231316 GTGCAGGTCAGGATGGAGGTGGG - Intronic
992120438 5:73586884-73586906 TCTCAGGTCAGAGTGGAGAGTGG - Intergenic
995047460 5:107669157-107669179 GCTGAGGGGAGGCTGGAGGCAGG + Intronic
995839884 5:116433613-116433635 GCTCAGGGAAGGCTTGGGGGAGG + Intergenic
997250953 5:132388121-132388143 GCAAAGGTCAGGCAGGAGTGTGG + Intronic
998043646 5:138969323-138969345 GCTGAGGTCAGGCTGAAAGGAGG - Intronic
998167401 5:139852080-139852102 TCTAAGGTAAGGCTGGGGGGAGG - Intronic
998508727 5:142693692-142693714 GCTTAGGCCTGGCAGGAGGGAGG - Intronic
999137785 5:149334376-149334398 TATCAGGTCATGCTGGTGGGAGG - Intronic
999282521 5:150374806-150374828 GCTCAGGTGAGGCAGAGGGGAGG + Exonic
999320234 5:150609950-150609972 GCTGAGGTCAGGCAGGGGTGTGG - Intronic
1000312741 5:160061092-160061114 GCTCAGGACAGCCTGGCAGGAGG + Intronic
1001221600 5:169905052-169905074 GCTGAGGTCAGGATTCAGGGAGG + Intronic
1001690974 5:173632170-173632192 GCTCAGTATGGGCTGGAGGGAGG + Intergenic
1002253962 5:177945371-177945393 GCTGAGGACAGGGTGCAGGGTGG + Intergenic
1002322255 5:178382933-178382955 GCTGAGGACAGGAGGGAGGGGGG + Intronic
1002492252 5:179586811-179586833 CCTCAGGTCAGGCAGGTCGGTGG + Intronic
1002880829 6:1251004-1251026 GCTGAGCACAGGCTGCAGGGTGG - Intergenic
1003147350 6:3519824-3519846 GATGAGGTCAGGCTGGATTGAGG + Intergenic
1003500041 6:6696050-6696072 GGTGAGGTCTGGCTGGAGGGGGG + Intergenic
1003886841 6:10529405-10529427 GTTCAGGTCAGCCTGGAGCCTGG - Exonic
1003890153 6:10556911-10556933 GTTCAGGTCAGCCTGGAGCCTGG - Intronic
1003893690 6:10586483-10586505 GTTCAGGTCAGCCTGGAGTCTGG - Intronic
1004275211 6:14230053-14230075 TCTCAGGTAAGGCAGCAGGGAGG + Intergenic
1004276643 6:14242407-14242429 GCCCAGGTCAGCCTGAGGGGAGG + Intergenic
1006651468 6:35555158-35555180 ACTCAGCTGAGGATGGAGGGAGG + Intergenic
1006746429 6:36346056-36346078 GTTCACGCCTGGCTGGAGGGTGG - Intergenic
1007195305 6:40055453-40055475 ACTCAGGTAAGGCAGGAGGTTGG + Intergenic
1007697803 6:43744669-43744691 GCTGGGGTCAGGGTGGAGAGGGG + Intergenic
1008880061 6:56372634-56372656 GCTTATGTAAGGCTGGAGTGGGG + Intronic
1010176755 6:73036502-73036524 GCTGGGGTCAGGCTGGAGAAGGG - Intronic
1013584587 6:111566907-111566929 GCTCAGAACCAGCTGGAGGGAGG - Intronic
1015823679 6:137289833-137289855 TCCCAGGACAGGCTGGAGGGTGG + Intergenic
1017006130 6:150029130-150029152 GGGCAGGTGAGGCTGGAGAGGGG - Intergenic
1018155149 6:160978683-160978705 GATGAGGTCATGCTGGAGGAGGG + Intergenic
1019212051 6:170414616-170414638 CCTAAGGTCATGCGGGAGGGTGG - Intergenic
1019362782 7:614023-614045 GTTCAGGTCAGCATGGAGGGCGG + Intronic
1020274817 7:6617478-6617500 GCTGAGGCCAGGCTGGTGAGGGG + Intronic
1020319493 7:6929531-6929553 GCTCAAGCCAGGCTGGGGGTTGG - Intergenic
1020969385 7:14915339-14915361 ATTCAGGCCAGGCTGGAGTGTGG - Intronic
1021973220 7:25985086-25985108 GCACTGGACAGGGTGGAGGGAGG - Intergenic
1022943773 7:35262211-35262233 GCACAGGGCAGGCTGGGGGCTGG + Intergenic
1023105106 7:36756116-36756138 TCTCAGGTCGGGGTGGTGGGTGG + Intergenic
1023132269 7:37014803-37014825 GTCCAGGACAGGATGGAGGGAGG + Intronic
1024648868 7:51388702-51388724 CCTCAGGTCAGCCTGGAAGTGGG - Intergenic
1024834579 7:53501306-53501328 TCACAGGTCAGGATGGAGGCTGG - Intergenic
1025871517 7:65438897-65438919 GCACAGGGCAGGCTGAAGAGTGG - Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029067301 7:97863629-97863651 GCCCAGCCCAGGCTGGAGTGCGG - Intronic
1029188194 7:98754399-98754421 GCTGGAGTCAGGCTGCAGGGAGG - Intergenic
1029416285 7:100445147-100445169 GGTCAGCTCAGCCTGGAGGATGG + Intergenic
1029440533 7:100584589-100584611 GCTGAGGTCAATCTGGAGTGTGG + Intronic
1029474233 7:100773556-100773578 GCTCAGGAGAGGCAGGAGGAAGG + Intronic
1029513432 7:101011030-101011052 GCTCAGGTCGGGGGTGAGGGAGG + Intronic
1029565160 7:101332047-101332069 TCACAGTTCAGGCTGGAGCGTGG + Intergenic
1029640549 7:101816784-101816806 GCTCCGGCCAGGCGGGCGGGTGG + Intronic
1030153062 7:106425640-106425662 GCCCAGGCCTGGCTGCAGGGAGG + Intergenic
1031083484 7:117280155-117280177 GCCGGGGTCAGGGTGGAGGGTGG + Intronic
1031976889 7:128099750-128099772 TGTTAGGACAGGCTGGAGGGAGG - Intergenic
1032193092 7:129775524-129775546 CCACAGGGCAGGCTGGGGGGTGG - Intergenic
1032461407 7:132114218-132114240 GCTGAGGCCAGGCTGGAGGAAGG - Intergenic
1032544006 7:132727084-132727106 GCTCAGGTCCTGCGGGAGAGGGG - Intronic
1032566583 7:132953375-132953397 CCTCAGGGCAGTCTGGAAGGTGG - Intronic
1033310741 7:140260103-140260125 GCGCAGGTCAGGAAGGAGGCAGG + Intergenic
1034273668 7:149814939-149814961 GCACAGGTCAGGCTTCAGTGAGG + Intergenic
1034332579 7:150295772-150295794 GCTCAGGACAGGCCGGTGTGAGG + Intronic
1034414896 7:150959248-150959270 GCTCAAGCCAGGCTGGAGAGAGG + Intronic
1034665457 7:152814103-152814125 GCTCAGGACAGGCCGGTGTGAGG - Intronic
1035624998 8:1064835-1064857 GTGCATGTCAGGGTGGAGGGGGG - Intergenic
1036709579 8:11069416-11069438 GCTCTGGCCAGGCTCCAGGGAGG - Intronic
1036774074 8:11598054-11598076 GCTCAGGTCAGGCTATAAGGAGG - Intergenic
1038317927 8:26503337-26503359 GCTCAGGAGAGGCTGGAAGGTGG - Intronic
1038971905 8:32646242-32646264 GCTGAGTACAGGCTGGAGGAAGG - Intronic
1042222797 8:66490156-66490178 GCCCAGCTCAGGAGGGAGGGAGG - Intronic
1044755646 8:95458403-95458425 GCCCAGGTCAGGGAGGAGGAAGG - Intergenic
1045244061 8:100427325-100427347 GCTAAGGTAAGGCTGAAGGTAGG - Intergenic
1048026586 8:130592739-130592761 GCTTAGGTAAGGCTGGAGGAGGG - Intergenic
1048292369 8:133190882-133190904 GCCAAGCTCAGGCTGGAGGTGGG + Intergenic
1048985572 8:139732975-139732997 GCTGAGGTCAGGGTGGGGTGGGG + Intronic
1049152284 8:141042757-141042779 GCTCAGGGCTGGCTCGAGGTAGG - Intergenic
1049335180 8:142080443-142080465 GCTCAGGACAGGGAGGAGAGGGG - Intergenic
1049389492 8:142360628-142360650 GCTCCCTTCAGGCTGGTGGGGGG - Intronic
1049798374 8:144506651-144506673 GCTCAGGTCAGGCGGGGGCGGGG + Exonic
1050031356 9:1389492-1389514 GCTTAGTTGAGGATGGAGGGTGG - Intergenic
1052570187 9:30210943-30210965 GCTCAAGGCAGGCAGGAGGTGGG + Intergenic
1052976177 9:34412017-34412039 GCTCAGATCATGCTGGAAGGTGG + Intronic
1053592956 9:39533069-39533091 CGTCAGGACAGGCGGGAGGGTGG - Intergenic
1054573350 9:66832208-66832230 CGTCAGGACAGGCGGGAGGGTGG + Intergenic
1056253904 9:84778739-84778761 GCACAGTTCAGGCAGGAGGGAGG - Intronic
1056893011 9:90513777-90513799 TCTAAGGTCATGCTGGAGAGAGG + Intergenic
1058673920 9:107384364-107384386 GCTAAAGTGTGGCTGGAGGGTGG + Intergenic
1060545451 9:124456558-124456580 GCTCAGGGCAGGCGGCAGTGGGG + Intronic
1060904146 9:127289599-127289621 GCTCAGGTCAGCCACGTGGGTGG - Intronic
1061050423 9:128191664-128191686 GCACAAGTCACGCTGGGGGGCGG + Intronic
1061149914 9:128822789-128822811 GATGAGGCCAGGCTGCAGGGCGG + Exonic
1061221702 9:129255800-129255822 AACCAGGTCAGGCTGGAAGGTGG - Intergenic
1061498021 9:130986687-130986709 CCTCAGGCCAGGCTGGGGGGGGG - Intergenic
1061674373 9:132207534-132207556 GCTGAGGTCATGCTGCAGGAGGG - Intronic
1061802788 9:133121262-133121284 GCTGATGTCAGGCTGGGGGGCGG + Intronic
1061843733 9:133375647-133375669 GCCCCGGGCTGGCTGGAGGGTGG + Intronic
1061989332 9:134149847-134149869 GCACTGCTCAGGCTGGACGGAGG - Intronic
1062147399 9:134997248-134997270 GCTCAGGCCTGGCCAGAGGGCGG + Intergenic
1062235670 9:135506492-135506514 GCTCAGGGCAGGGTGGGGTGGGG + Intergenic
1062252065 9:135603246-135603268 GGTCACGTCAGGCTGGAGTGGGG - Intergenic
1062308274 9:135921707-135921729 GATCAGGTCACCCAGGAGGGTGG - Intergenic
1062392701 9:136340286-136340308 GCCCAGGTGAGGGTGGAGAGGGG + Intronic
1062450983 9:136615707-136615729 GCTAAGGCCAGGCTGCATGGAGG - Intergenic
1062460519 9:136660850-136660872 GCCCAGGTGAGCCTGGAGGCCGG - Intronic
1062580772 9:137228355-137228377 GCTCAGGTCGGCCAGGAGGGTGG + Intronic
1203744571 Un_GL000218v1:34814-34836 GTGCAGGGCAGGGTGGAGGGAGG + Intergenic
1203565530 Un_KI270744v1:84670-84692 GTGCAGGGCAGGGTGGAGGGAGG - Intergenic
1185672982 X:1826487-1826509 GGTGAGGTGAGGCTGGATGGAGG - Intergenic
1186727007 X:12367989-12368011 GCTAAGGTCATGCAGGAGGATGG - Intronic
1186849806 X:13569540-13569562 GCGCGGGTCATGCTGGAGGCGGG + Intergenic
1187045795 X:15646796-15646818 GCTGCGGACAGGCTGGTGGGGGG - Intronic
1189286887 X:39858073-39858095 GCTCAGGATAGGCAGGAGGCTGG - Intergenic
1190160824 X:48030291-48030313 GCTCAGGTCCCACTGGAGAGTGG - Intronic
1190320317 X:49176141-49176163 GCGCAGGTTAGGCTGGCCGGGGG + Exonic
1193069998 X:77297090-77297112 GCTTAGGACAGGCAGGAGGAGGG - Intergenic
1193996844 X:88375679-88375701 GATCAAGTCGGGCTGGAGGTGGG - Intergenic
1194712505 X:97252791-97252813 CTTCAGATTAGGCTGGAGGGGGG + Intronic
1199161954 X:144623373-144623395 GCCAAAGTCAGACTGGAGGGAGG + Intergenic
1200075228 X:153547377-153547399 GCGCAGGGCTGGCTGGTGGGAGG + Intronic
1200216647 X:154371030-154371052 GCTCAGGTCCGTCTGCAGGTTGG + Exonic
1201157906 Y:11149797-11149819 GTGCAGGGCAGGGTGGAGGGAGG + Intergenic
1201901078 Y:19046641-19046663 GCTCAGGCCGCGCTGGAGCGGGG + Intergenic
1202275684 Y:23117246-23117268 GCGCACTTCAGGCAGGAGGGTGG + Intergenic
1202290344 Y:23303445-23303467 GCGCACTTCAGGCAGGAGGGTGG - Intergenic
1202380728 Y:24275008-24275030 GTCCAGGTCAGGCTGGAGTCAGG - Intergenic
1202428676 Y:24750965-24750987 GCGCACTTCAGGCAGGAGGGTGG + Intergenic
1202442115 Y:24919124-24919146 GCGCACTTCAGGCAGGAGGGTGG - Intergenic
1202490056 Y:25395117-25395139 GTCCAGGTCAGGCTGGAGTCAGG + Intergenic