ID: 949052396

View in Genome Browser
Species Human (GRCh38)
Location 2:241904115-241904137
Sequence CTGGAGCCATATCTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949052383_949052396 17 Left 949052383 2:241904075-241904097 CCAGGAGCTGACCTGGGAGGCAG 0: 1
1: 1
2: 2
3: 56
4: 420
Right 949052396 2:241904115-241904137 CTGGAGCCATATCTGGGGCTGGG 0: 1
1: 1
2: 0
3: 27
4: 249
949052389_949052396 6 Left 949052389 2:241904086-241904108 CCTGGGAGGCAGGGAGGCAGGGA 0: 1
1: 7
2: 40
3: 299
4: 1912
Right 949052396 2:241904115-241904137 CTGGAGCCATATCTGGGGCTGGG 0: 1
1: 1
2: 0
3: 27
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949052396 Original CRISPR CTGGAGCCATATCTGGGGCT GGG Intergenic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900628110 1:3618756-3618778 ATGGAGCCAGGGCTGGGGCTTGG - Intergenic
901070001 1:6512349-6512371 CAGGGGGCACATCTGGGGCTGGG - Intronic
901858228 1:12057702-12057724 CTGGGGCCATAGCAGGGGCCTGG + Intergenic
902631174 1:17705551-17705573 CTGGGGCTAGAGCTGGGGCTGGG + Intergenic
902797577 1:18809313-18809335 CTGAAGCAACAACTGGGGCTTGG + Intergenic
903163889 1:21508074-21508096 TTGGAGCCAGAACTGGGGCCTGG - Intergenic
903166586 1:21524699-21524721 TTGGAGCCAGATCTGGGGAGGGG + Intronic
905028613 1:34867037-34867059 CTGGAGCCTAAGGTGGGGCTGGG - Exonic
905692887 1:39955697-39955719 CTGGGGTCATCTCTGGGGTTTGG - Intronic
907524944 1:55048557-55048579 CTGGAGTCATATCAAGGGCTTGG + Intronic
911944650 1:104091834-104091856 CTGGATCTATATCTGGGTCCCGG + Intergenic
913533395 1:119749021-119749043 CTGGAGCCAAGGCTGGGGGTAGG + Intronic
913680926 1:121186545-121186567 CTGGGGCCACGTCGGGGGCTAGG + Intronic
914032756 1:143974184-143974206 CTGGGGCCACGTCGGGGGCTAGG + Intergenic
914156688 1:145093781-145093803 CTGGGGCCACGTCGGGGGCTAGG - Intronic
915006775 1:152645471-152645493 CAGGACCCCTCTCTGGGGCTAGG + Intergenic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915423561 1:155805033-155805055 CTGGAGTGATGTCTGGAGCTTGG + Exonic
916091332 1:161309896-161309918 CAGGAGCCATAGCTGGGGCAGGG + Exonic
916560560 1:165931127-165931149 GTGGATCCATGGCTGGGGCTGGG + Intergenic
918177691 1:182059998-182060020 CTGAAGCCTGCTCTGGGGCTGGG + Intronic
920106789 1:203559121-203559143 CTGCAGCCATCTCTGAGGCCAGG + Intergenic
920312538 1:205057076-205057098 CTGGAGCCACATGTGGGGTGGGG - Intronic
920404251 1:205697215-205697237 CTGGAGCCAGAGATGTGGCTGGG - Intergenic
920468239 1:206205069-206205091 CTGGGGCCACGTCGGGGGCTAGG + Intronic
922160818 1:223078166-223078188 CTGGGGCCATATATGAGGGTGGG + Intergenic
922914917 1:229249384-229249406 ATGGAGCCAAAACTGGGACTAGG - Intergenic
922937686 1:229434176-229434198 CTCGAGCCATATTTGGGTGTTGG + Intergenic
1063626764 10:7697701-7697723 CTGGGCCCATGTCTCGGGCTTGG + Intergenic
1063626772 10:7697743-7697765 CTGGGCCCATGTCTCGGGCTTGG + Intergenic
1067524261 10:47028750-47028772 TTGGGGCCAGATCTGGGGCAGGG - Intergenic
1067839752 10:49666237-49666259 CTGGAGCTGGAGCTGGGGCTGGG - Intergenic
1070796522 10:79220075-79220097 CCGGTGCCATGTCTGGGACTTGG - Intronic
1072091899 10:92137072-92137094 CTCAAGCCCTATCTGGGACTGGG + Intronic
1073205189 10:101765379-101765401 CCGGAGCTTTACCTGGGGCTAGG - Intergenic
1073284611 10:102380181-102380203 CTGGACCCCTCTCTGAGGCTGGG - Intronic
1073314336 10:102567859-102567881 CTGGAGCTAGGCCTGGGGCTAGG - Intronic
1074047981 10:109856694-109856716 CCTGAGCAATAGCTGGGGCTGGG + Intergenic
1074855949 10:117473593-117473615 CAGGGGCCACATCTGGGGCGGGG + Intergenic
1076481020 10:130785384-130785406 CAGAAGCCATGTCTGGGACTAGG - Intergenic
1077870591 11:6259086-6259108 CTGGAGCCAAATCTCGGCCCCGG + Intergenic
1079131284 11:17748332-17748354 GAGGAGGCATATCTGGGGCTGGG + Intronic
1080076731 11:28158472-28158494 ATGGTGCCATATCGAGGGCTTGG - Intronic
1080392491 11:31861198-31861220 CTGCAGCAAGATCTGGGGCGTGG + Intronic
1081355716 11:42110526-42110548 CAGGAGCCAGATCTGGTGATAGG + Intergenic
1081393702 11:42560112-42560134 ATGAAGACATATCTGAGGCTGGG - Intergenic
1081847703 11:46252597-46252619 CTGGATCCTGAGCTGGGGCTGGG + Intergenic
1082929918 11:58591871-58591893 ATGGTGCCATATCAGGGACTCGG + Intronic
1083712017 11:64555330-64555352 CTGAAGCCAGATGTGGGGCCTGG - Intergenic
1084884713 11:72196092-72196114 CTGCAGCCATGAGTGGGGCTGGG + Exonic
1084891306 11:72238400-72238422 CTGGGGCCATAGCTGGGCCTTGG - Exonic
1086278741 11:85161409-85161431 ATGGTGCCATATCGAGGGCTCGG - Intronic
1086974072 11:93113237-93113259 GTGGAGCCATATGAGGGGCAGGG + Intergenic
1087490877 11:98825459-98825481 CAGAAGCCATGTCTGGGTCTTGG - Intergenic
1088814086 11:113409899-113409921 CTGGAACTCTATCTGGGCCTGGG - Exonic
1089698663 11:120231042-120231064 CTGGAGCAATGGCTGGGGCTTGG - Intergenic
1089972623 11:122706295-122706317 CTGGATTCAGATCTAGGGCTTGG + Intronic
1090175231 11:124642968-124642990 CTGGAGTCTCATCTGAGGCTTGG - Intronic
1090349080 11:126095741-126095763 CTGGAGACAGATCTGGGGTGAGG + Intergenic
1090851424 11:130573897-130573919 CTGGAGCCATATCCTGGCCCAGG + Intergenic
1091297945 11:134486859-134486881 CTGGAGCCTTTGCTGGGTCTGGG + Intergenic
1093493112 12:19726546-19726568 CTGCAGCCATGCCTGGGGCGGGG + Intergenic
1095720837 12:45398997-45399019 CTGGAGCCATACCTCAGGCCTGG - Intronic
1096090227 12:48894529-48894551 CTGGTGCCACATCTGGGCCTGGG - Intergenic
1096197399 12:49657479-49657501 CTGGAGCCATCTCAGGGACTAGG - Intronic
1096464502 12:51840949-51840971 AAGGGGCCATATTTGGGGCTAGG - Intergenic
1096664412 12:53153492-53153514 CTCAAGCCCAATCTGGGGCTGGG + Intergenic
1104989631 12:132618553-132618575 CTGGACCAAGAGCTGGGGCTGGG + Intergenic
1105462957 13:20608702-20608724 CGGGATCCATCTCTGTGGCTGGG - Intronic
1105534887 13:21256751-21256773 CAGGAGCCATCCCTGGTGCTGGG + Intergenic
1106461520 13:29974390-29974412 CTGAAGCCAGTTCTGTGGCTGGG - Intergenic
1108722183 13:53143433-53143455 CTGCAGCCATCTCTAGTGCTGGG - Intergenic
1109940092 13:69350440-69350462 CTGGAGAGAAATCTGGAGCTGGG + Intergenic
1111923924 13:94442543-94442565 GTGGAGCCATATTGGGGCCTGGG + Intronic
1113764078 13:112870001-112870023 GTGGAGACATTTCTGGGGCGTGG - Intronic
1115152933 14:30306187-30306209 ATGGAGCAATATCAGGTGCTGGG - Intergenic
1115367286 14:32572448-32572470 CTTGTGCCATATATGGGGCCAGG - Intronic
1118122304 14:62859222-62859244 ATGGTGCCATATCGAGGGCTCGG + Intronic
1120092740 14:80352268-80352290 CTGTATCCATATCTGGGTTTTGG - Intronic
1121711549 14:96042430-96042452 CTGGAGGGATTCCTGGGGCTGGG + Intronic
1122128912 14:99593829-99593851 CTGCACCCATCTCTGGGGCTGGG + Intronic
1122247936 14:100417416-100417438 ATGGAGCCATGTGTGGGGCCAGG + Intronic
1122588955 14:102831650-102831672 CGGGACCCATGGCTGGGGCTGGG - Intronic
1122757003 14:103989660-103989682 ATGGTGCCATATTTGGGACTTGG + Intronic
1122841313 14:104465100-104465122 ATGGTGCCATATCAAGGGCTTGG + Intergenic
1127983608 15:64051670-64051692 CTGAGGCCAGATCAGGGGCTAGG + Intronic
1128355456 15:66923422-66923444 CAGGATCCATCTCTGGGGCTGGG + Intergenic
1128754532 15:70172403-70172425 CCTGGGCCATATCTGGGCCTGGG + Intergenic
1129955973 15:79637165-79637187 CAGGAGCCATCTCTGGAGCGGGG - Intergenic
1130016986 15:80195260-80195282 ATGGTGCCATATCAGGGGCTTGG - Intergenic
1131030302 15:89180681-89180703 CAGGAGCCCTGTCTTGGGCTTGG + Intronic
1132850681 16:2023676-2023698 CTGGGGCCCTGTCTGGGGGTGGG - Intergenic
1133267659 16:4594558-4594580 CTGGTCCCACACCTGGGGCTGGG - Intronic
1133721126 16:8495332-8495354 CTGAAGCCATCTCTGTGGGTGGG - Intergenic
1133723546 16:8516995-8517017 CTGGAACCATCTTTGTGGCTGGG + Intergenic
1133855782 16:9547956-9547978 CTGCAGCTAGGTCTGGGGCTGGG + Intergenic
1134442395 16:14307085-14307107 CTGAGGCCACATCTGGGCCTCGG - Intergenic
1136140081 16:28282726-28282748 TTGGAGCCATGTGAGGGGCTTGG - Intergenic
1137682778 16:50365219-50365241 CTGGAGCCAACTATGGGGCAGGG - Intronic
1142261419 16:89044183-89044205 CTGATGCCCGATCTGGGGCTGGG + Intergenic
1142274228 16:89107816-89107838 ATGCAGCCACATTTGGGGCTGGG - Intronic
1143185698 17:5008721-5008743 CTGGGGTCTTGTCTGGGGCTGGG + Intronic
1144363394 17:14518461-14518483 CTGGACCCATAACTGGTGCAAGG + Intergenic
1144381943 17:14708284-14708306 CAGGAGCCATATCTTTGTCTTGG + Intergenic
1145761038 17:27425639-27425661 CTGGAGCCCTTCATGGGGCTGGG + Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146256921 17:31397045-31397067 CAGGAGCCAGCCCTGGGGCTGGG + Intronic
1146840840 17:36153104-36153126 CTGGAGCAACATCTGGGGGCTGG + Intergenic
1147253538 17:39167610-39167632 AAGGAGCCAAGTCTGGGGCTGGG + Intergenic
1147324914 17:39665549-39665571 CTGGAGAAATTTCTGGGGGTGGG + Intronic
1147374085 17:40013915-40013937 ATGGGGCCATCTCTGGTGCTTGG - Intergenic
1147462154 17:40580004-40580026 CTGCAGCCATATTGGGGGTTAGG + Intergenic
1147900162 17:43778659-43778681 CGGGAGCCACAGCGGGGGCTTGG - Intronic
1148029649 17:44610617-44610639 CTGGTCCCATAGCTGGGGGTGGG - Intergenic
1148440661 17:47710220-47710242 CTGGGGGCATGTCTGGGTCTTGG + Intronic
1148623933 17:49054677-49054699 CTGGAGTGAGACCTGGGGCTTGG + Exonic
1149481397 17:57006119-57006141 CTGGTGCTATTCCTGGGGCTGGG - Intronic
1149557942 17:57587563-57587585 CTGCAGCCACCTTTGGGGCTGGG - Intronic
1149858688 17:60107864-60107886 CTGGAGCAATATCTGGGGACTGG - Intergenic
1151006218 17:70439233-70439255 CTGGAGCCAGCTCTTGAGCTGGG + Intergenic
1152085112 17:78213363-78213385 CTGGAGTCACTTCTGGAGCTGGG - Intergenic
1156516649 18:37685944-37685966 CTGGTTCCAAATCTGGTGCTAGG - Intergenic
1157045704 18:44099859-44099881 CTGGAGACATACCTGAGACTGGG - Intergenic
1157698601 18:49745020-49745042 CTGGAGCCACATGGGTGGCTGGG + Intergenic
1161138101 19:2632612-2632634 CTGGATCCATCTCTGGGGTGAGG + Intronic
1161267958 19:3373747-3373769 CTGGATCCAGATCTGGGGCAGGG - Intronic
1163317738 19:16553113-16553135 CTGGATCCATCTCTGTGGCTGGG + Exonic
1163364377 19:16867967-16867989 CTGGATCCCTCCCTGGGGCTGGG + Intronic
1164972916 19:32547797-32547819 CTGAAGGCCCATCTGGGGCTGGG - Intergenic
1164984344 19:32637689-32637711 CTGGATCCAGAGCTGCGGCTGGG - Intronic
1165804498 19:38572333-38572355 CTGGAGCACTGGCTGGGGCTGGG + Intronic
1167388420 19:49178415-49178437 CTTGAGCTATAGCTGGGGCCAGG + Intronic
1167776891 19:51564378-51564400 GGGGAGCCATTCCTGGGGCTGGG - Intergenic
1167792708 19:51691148-51691170 CTCGAGCCAGGTCTGGAGCTGGG - Intergenic
1168059105 19:53881573-53881595 CTGTCGCCATCTCTGGGTCTTGG - Intronic
925242718 2:2346521-2346543 CTGGACCACAATCTGGGGCTAGG + Intergenic
925712432 2:6754396-6754418 CTGGGGCCACATCTGGGACTGGG + Intergenic
926107824 2:10163349-10163371 CTGTAGCTGTCTCTGGGGCTGGG + Intronic
926134048 2:10324367-10324389 CTGGAGTCAGGTCTGGGGCCAGG + Intronic
926238443 2:11067537-11067559 CTGGAACCATTTGTGGAGCTTGG - Intergenic
927712525 2:25334493-25334515 CTGGAGGTATAACTGGGGCCCGG - Intronic
928231116 2:29499809-29499831 CTGGAGTCAGATCTATGGCTAGG - Intronic
928437136 2:31261886-31261908 CAGGGGCCATGTCTGGGCCTGGG + Intronic
933741474 2:85538012-85538034 CTGCAGCCTGTTCTGGGGCTGGG - Intergenic
935452107 2:103221831-103221853 CTGGAGGCAGATCAGTGGCTGGG + Intergenic
936989286 2:118345469-118345491 CTGAAGGCATACCTGAGGCTGGG - Intergenic
937079630 2:119131333-119131355 CTGTGGTCATCTCTGGGGCTAGG + Intergenic
937739615 2:125334245-125334267 CTGCAGCCATATCTGTGCCAGGG - Intergenic
940099422 2:150017058-150017080 ATGAAGAAATATCTGGGGCTGGG + Intergenic
941506784 2:166356095-166356117 CTGGAGTCTTGTCTGAGGCTGGG + Intronic
943841690 2:192591341-192591363 ATGAAGACATATCTGGGACTGGG - Intergenic
944766537 2:202870960-202870982 CAGGAGCCATATCTGTGCCGTGG + Intronic
945090730 2:206173317-206173339 CAGAAGCCATATCTGTGTCTTGG + Intergenic
947478094 2:230469819-230469841 CAGGAGCCCTCTCTGAGGCTGGG - Intronic
947551668 2:231050911-231050933 CAGGAGCCCCAGCTGGGGCTGGG - Intergenic
948760562 2:240187822-240187844 CTGGGGCCATATCAGTGGATGGG + Intergenic
948851755 2:240711697-240711719 CTGGAACCATCTCAGGGTCTGGG + Intergenic
949052396 2:241904115-241904137 CTGGAGCCATATCTGGGGCTGGG + Intergenic
1174528905 20:51195474-51195496 ATGAAGCAATATCTGAGGCTGGG + Intergenic
1175518993 20:59587746-59587768 CTGGAGCCGGGGCTGGGGCTGGG + Intronic
1175681461 20:60991837-60991859 CCGGAGACACATCTGGGTCTGGG + Intergenic
1179984717 21:44913999-44914021 CTGGGGCCAGCTCAGGGGCTGGG - Intronic
1180955818 22:19740782-19740804 CTGGAGCCCGAGCTGGGCCTCGG + Intergenic
1181036185 22:20170781-20170803 CTGGAGCCTGGTCTGGGGCTAGG + Intergenic
1182712615 22:32332106-32332128 CTGCAGCCATGTCTGCGGCTTGG - Intergenic
1182900534 22:33894683-33894705 CTGGACCCATATCTGGTCCAAGG + Intronic
1183323309 22:37178080-37178102 CTGGATCCATTTCATGGGCTAGG - Intergenic
1184091781 22:42296667-42296689 CTGGAGCCCTGTTTGGGGGTGGG - Intronic
1184399856 22:44267488-44267510 CTGCAGCCATGTCTGTGGCTTGG - Intronic
1184768013 22:46582054-46582076 CTGGGGCCTTGGCTGGGGCTGGG + Intronic
1184867463 22:47209583-47209605 GTGGAGACCTCTCTGGGGCTCGG - Intergenic
1185015974 22:48342785-48342807 CTGGGGCCAAATCTGGGTCATGG + Intergenic
950427979 3:12934952-12934974 CTGAGGCCATGTCTGGGGGTAGG - Intronic
953569980 3:44063577-44063599 TTGCAGTCAGATCTGGGGCTGGG + Intergenic
953655343 3:44847435-44847457 ATGAAGACATATCTGGTGCTTGG + Intronic
954289651 3:49642863-49642885 CTGGAGCCAAAACTGAGCCTGGG + Exonic
958082044 3:88759083-88759105 CTGGAGCCATATCCTAGGCTAGG + Intergenic
962306133 3:134287990-134288012 CTGAAGGCAAATCTGGAGCTCGG - Intergenic
962346662 3:134623870-134623892 CTGGAGCCATCAAAGGGGCTGGG - Intronic
962868396 3:139466898-139466920 GAGGAGGCAAATCTGGGGCTCGG - Intronic
965683086 3:171272208-171272230 CTGGAGCCATGACTGGTGTTGGG + Intronic
967883682 3:194318804-194318826 CTGGAGCTGTACCTGGGCCTGGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969614811 4:8246222-8246244 CTGGAGGGATGCCTGGGGCTCGG - Intergenic
969712513 4:8852080-8852102 TTGGAGCCAGAGCCGGGGCTTGG - Intronic
970170473 4:13284307-13284329 CTGTAGCCACCTCAGGGGCTTGG - Intergenic
970886368 4:20991788-20991810 TTGTAGCCATGGCTGGGGCTTGG + Intronic
971344040 4:25796179-25796201 GTGGAGCCTTCTCTGGGGCTTGG - Intronic
973765475 4:54157642-54157664 CTGGACCAATCTCTGAGGCTAGG - Intronic
975661219 4:76690306-76690328 CTGGAGCACTCTCTGGGGGTGGG + Intronic
977928627 4:102728861-102728883 CCAGAGCCAAAGCTGGGGCTTGG + Intronic
979685214 4:123504321-123504343 CTGGAGCCATGTATGTGGATGGG + Intergenic
981616494 4:146648845-146648867 CTACAGCCAATTCTGGGGCTGGG - Intergenic
985664827 5:1176684-1176706 CTGGGGCCAGAGCCGGGGCTGGG - Intergenic
985787013 5:1901604-1901626 CTCGAGCCATCACTGGGGCAGGG - Intergenic
986413178 5:7502305-7502327 CTGGCCTCATATGTGGGGCTCGG - Intronic
986552940 5:8978916-8978938 ATGCAGCCATATAAGGGGCTGGG - Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987230502 5:15889015-15889037 CTGTAGAAATATCTGGGCCTTGG + Intronic
988376372 5:30440226-30440248 CTGGAGCCATATCTGCATCAAGG - Intergenic
990329085 5:54707702-54707724 CAGGAGCCGCATCTGGGTCTAGG + Intergenic
993852008 5:93022221-93022243 CTGGAGACAGATGAGGGGCTGGG + Intergenic
994984276 5:106914773-106914795 ATGGTGCCATATCGAGGGCTTGG + Intergenic
995859638 5:116627964-116627986 AAAGAGCCACATCTGGGGCTGGG + Intergenic
997459341 5:134041689-134041711 TTGGAGCCATGCCTGGGACTTGG + Intergenic
997507166 5:134426652-134426674 CTTGAGCCATTTCTGGGGGTGGG - Intergenic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
997868998 5:137490323-137490345 CTAAAGCCAAATCTGGAGCTTGG + Intronic
1001309651 5:170601871-170601893 CTGGAGTCTTACCTGGGCCTTGG + Intronic
1002536631 5:179879546-179879568 CTGGAGCCAGTCCTGGGCCTGGG - Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002931316 6:1637055-1637077 CTGGAGCCATGCCTGGCGCTGGG - Intronic
1004828669 6:19452591-19452613 CCAGAGTCATCTCTGGGGCTTGG - Intergenic
1005655597 6:27933260-27933282 CTGGCTCCTTATCTGGGGCTGGG + Intergenic
1005913085 6:30327374-30327396 CTTCCGCCAGATCTGGGGCTGGG - Intronic
1006387495 6:33739453-33739475 CTGGAGCTTCAGCTGGGGCTGGG + Intronic
1007380935 6:41489694-41489716 CGGGAGCCCTGCCTGGGGCTGGG - Intergenic
1010070505 6:71738715-71738737 ATGGTGCCATATCAGGAGCTTGG - Intergenic
1012027638 6:94017819-94017841 CTGGAGACATATGTAGGGATAGG - Intergenic
1013182349 6:107728822-107728844 ACAGAGCCACATCTGGGGCTTGG - Intronic
1014397776 6:120947598-120947620 CTGGAACTATATCTAAGGCTGGG - Intergenic
1016203697 6:141446222-141446244 CATGAGCCTTATCTGGAGCTAGG - Intergenic
1016854109 6:148649407-148649429 CTGGAGCAATAGCTGAGTCTTGG - Intergenic
1017002301 6:150005020-150005042 CTGGAGCCTAATCGGGGGCTGGG - Intergenic
1017130047 6:151100447-151100469 CTGGAGCCAGATAAGGTGCTTGG - Intronic
1019751280 7:2731607-2731629 CTGGAACCACTTCTGGCGCTGGG + Exonic
1019947171 7:4339016-4339038 GTAAAGACATATCTGGGGCTGGG + Intergenic
1020841305 7:13221378-13221400 CTTAAAACATATCTGGGGCTGGG + Intergenic
1022119566 7:27294857-27294879 CTGGAGACCTCTCTGGGTCTTGG + Intergenic
1023087309 7:36583839-36583861 CTAGAATCAAATCTGGGGCTGGG - Intronic
1024744343 7:52389378-52389400 ATGGTGCCATATCAAGGGCTTGG - Intergenic
1029606558 7:101602683-101602705 CTGGGGCCATATCTGGTGCAGGG - Intergenic
1030035087 7:105402046-105402068 CAGCACCCATATCTGGGGCTGGG - Intergenic
1030079140 7:105762410-105762432 CTGGAACCAAATCTGAGCCTTGG + Intronic
1030086168 7:105817687-105817709 CTGGAGCAACATTTGAGGCTGGG + Intronic
1033262476 7:139855662-139855684 CAGAAGCCATATCTGGAGCAAGG + Intronic
1033305354 7:140221528-140221550 CTGAATGCATCTCTGGGGCTTGG + Intergenic
1033828196 7:145218413-145218435 CAGGAGCCATAGCTGGGTCTAGG + Intergenic
1034257023 7:149730248-149730270 CTGGAGCCGGGGCTGGGGCTGGG - Exonic
1034424343 7:151006804-151006826 CTGAAGCCGTCCCTGGGGCTGGG + Intronic
1034561284 7:151880875-151880897 CTGGGGCTGGATCTGGGGCTGGG + Intergenic
1036586046 8:10124515-10124537 CTGGTGCCATAATTGGAGCTAGG + Intronic
1038613502 8:29073239-29073261 CAGGTGCCATGTCAGGGGCTGGG + Intronic
1039918173 8:41875043-41875065 CTCGGTCCATATATGGGGCTGGG + Intronic
1040912075 8:52529368-52529390 ATGGTGCCATATCAAGGGCTCGG - Intergenic
1043075821 8:75698229-75698251 CTGGAGACTTGGCTGGGGCTGGG + Intergenic
1043348846 8:79334497-79334519 CTGGAGCAAGAGCTGTGGCTGGG + Intergenic
1047773470 8:128049478-128049500 CTGGAGACCTACCAGGGGCTGGG + Intergenic
1049444402 8:142623434-142623456 CCGGTGGCAGATCTGGGGCTTGG + Intergenic
1050482812 9:6103550-6103572 ATGGTGCCATATCGAGGGCTCGG - Intergenic
1051326748 9:15980381-15980403 CTGGAGAGATCACTGGGGCTAGG - Intronic
1055215831 9:73860967-73860989 CTGTAGCCAAGTCTGAGGCTAGG - Intergenic
1056401415 9:86231127-86231149 CTGGAGGCTCGTCTGGGGCTGGG - Intronic
1057511651 9:95684847-95684869 CTGCTGGCAAATCTGGGGCTGGG - Intergenic
1058261122 9:102833460-102833482 CAGAAGCAATCTCTGGGGCTGGG - Intergenic
1059364946 9:113779616-113779638 CTGGATCCAGCTCTGAGGCTGGG + Intergenic
1059655212 9:116351839-116351861 CTGGAAACATGTCGGGGGCTCGG - Intronic
1060285532 9:122248412-122248434 CTGGAACCATATCCTGGACTAGG + Intronic
1060557402 9:124515511-124515533 ATGGAACCATCTCTGGGGGTGGG + Intergenic
1061289078 9:129640705-129640727 CTGGCGACATAACTGGGCCTGGG + Exonic
1061415080 9:130443196-130443218 CTGGAACCATTTCTGCGGCAAGG + Intergenic
1061801421 9:133115252-133115274 CTGGAGCCATCCATGGGGCAGGG - Intronic
1062016621 9:134294355-134294377 CTGGAGCCCTCTCTGGCGCTGGG - Intergenic
1190339481 X:49285811-49285833 CTGGAGCCATGGCCGGGGCAAGG - Intronic
1190637111 X:52446178-52446200 ATGAAGCCATTTCTGGGGTTTGG + Intergenic
1191759484 X:64630848-64630870 ATGGTGCCATATCGAGGGCTTGG - Intergenic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1194871601 X:99139494-99139516 CTGGAGCTATATCATTGGCTTGG - Intergenic
1195095057 X:101493889-101493911 CTGCATCCAGATCAGGGGCTGGG + Exonic
1195312149 X:103642227-103642249 CTGCAGTCTTATCTGGAGCTTGG - Intergenic
1195411430 X:104570687-104570709 TTGGAACCATGTCTGTGGCTGGG - Intronic
1197405175 X:126039893-126039915 ATGGTGCCATATCTAGTGCTCGG - Intergenic
1198271373 X:135059254-135059276 CTGGTGCCTGATGTGGGGCTAGG + Intergenic
1199243449 X:145575147-145575169 CTTGAGCCATAGCTAGAGCTGGG - Intergenic
1200182076 X:154156687-154156709 CTGGAGCTCTGGCTGGGGCTGGG - Intronic
1200309840 X:155066940-155066962 CTGAAATGATATCTGGGGCTTGG - Intronic
1200980816 Y:9261783-9261805 CTTGGGCCATATCTGTGGTTGGG - Intergenic