ID: 949052606

View in Genome Browser
Species Human (GRCh38)
Location 2:241905209-241905231
Sequence CCGGGGAAGGGACTGTGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949052606_949052619 9 Left 949052606 2:241905209-241905231 CCTCGTCACAGTCCCTTCCCCGG No data
Right 949052619 2:241905241-241905263 TGGTGCTGGGCACCACACTTAGG No data
949052606_949052616 -4 Left 949052606 2:241905209-241905231 CCTCGTCACAGTCCCTTCCCCGG No data
Right 949052616 2:241905228-241905250 CCGGGCCCGTCACTGGTGCTGGG No data
949052606_949052614 -5 Left 949052606 2:241905209-241905231 CCTCGTCACAGTCCCTTCCCCGG No data
Right 949052614 2:241905227-241905249 CCCGGGCCCGTCACTGGTGCTGG No data
949052606_949052622 30 Left 949052606 2:241905209-241905231 CCTCGTCACAGTCCCTTCCCCGG No data
Right 949052622 2:241905262-241905284 GGCCTGGCCGTCCTCTGCCCAGG No data
949052606_949052620 14 Left 949052606 2:241905209-241905231 CCTCGTCACAGTCCCTTCCCCGG No data
Right 949052620 2:241905246-241905268 CTGGGCACCACACTTAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949052606 Original CRISPR CCGGGGAAGGGACTGTGACG AGG (reversed) Intergenic
No off target data available for this crispr