ID: 949052890

View in Genome Browser
Species Human (GRCh38)
Location 2:241906714-241906736
Sequence TCCCTATATTGAGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949052887_949052890 8 Left 949052887 2:241906683-241906705 CCATAAAACAAAGGAAAATTTGT 0: 26
1: 17
2: 18
3: 83
4: 931
Right 949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949052890 Original CRISPR TCCCTATATTGAGGGAGTGC TGG Intergenic
No off target data available for this crispr