ID: 949055758

View in Genome Browser
Species Human (GRCh38)
Location 2:241927599-241927621
Sequence CTCCCACTCCTCACAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949055748_949055758 30 Left 949055748 2:241927546-241927568 CCTTAATTAGTAGGCGTTAAAGA No data
Right 949055758 2:241927599-241927621 CTCCCACTCCTCACAGTGGTGGG No data
949055753_949055758 4 Left 949055753 2:241927572-241927594 CCTGGGAAAGGCAGAGGCCAACA No data
Right 949055758 2:241927599-241927621 CTCCCACTCCTCACAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949055758 Original CRISPR CTCCCACTCCTCACAGTGGT GGG Intergenic
No off target data available for this crispr