ID: 949057651

View in Genome Browser
Species Human (GRCh38)
Location 2:241937156-241937178
Sequence CTCCCACTCCGGCCCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949057651_949057658 3 Left 949057651 2:241937156-241937178 CCTTCCACGGGCCGGAGTGGGAG No data
Right 949057658 2:241937182-241937204 AGGGTAGGAATGATTCCCTTGGG No data
949057651_949057659 4 Left 949057651 2:241937156-241937178 CCTTCCACGGGCCGGAGTGGGAG No data
Right 949057659 2:241937183-241937205 GGGTAGGAATGATTCCCTTGGGG No data
949057651_949057662 18 Left 949057651 2:241937156-241937178 CCTTCCACGGGCCGGAGTGGGAG No data
Right 949057662 2:241937197-241937219 CCCTTGGGGGATAAGAATCCTGG No data
949057651_949057657 2 Left 949057651 2:241937156-241937178 CCTTCCACGGGCCGGAGTGGGAG No data
Right 949057657 2:241937181-241937203 GAGGGTAGGAATGATTCCCTTGG No data
949057651_949057660 5 Left 949057651 2:241937156-241937178 CCTTCCACGGGCCGGAGTGGGAG No data
Right 949057660 2:241937184-241937206 GGTAGGAATGATTCCCTTGGGGG No data
949057651_949057664 25 Left 949057651 2:241937156-241937178 CCTTCCACGGGCCGGAGTGGGAG No data
Right 949057664 2:241937204-241937226 GGGATAAGAATCCTGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949057651 Original CRISPR CTCCCACTCCGGCCCGTGGA AGG (reversed) Intergenic
No off target data available for this crispr