ID: 949058556

View in Genome Browser
Species Human (GRCh38)
Location 2:241943288-241943310
Sequence CTGCAGAAAGGGACTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949058556_949058562 21 Left 949058556 2:241943288-241943310 CCCTCTGCAGTCCCTTTCTGCAG No data
Right 949058562 2:241943332-241943354 GAGAAGCTTCCCTGCATTCCAGG No data
949058556_949058563 22 Left 949058556 2:241943288-241943310 CCCTCTGCAGTCCCTTTCTGCAG No data
Right 949058563 2:241943333-241943355 AGAAGCTTCCCTGCATTCCAGGG No data
949058556_949058560 -1 Left 949058556 2:241943288-241943310 CCCTCTGCAGTCCCTTTCTGCAG No data
Right 949058560 2:241943310-241943332 GACTCTCTTCCGTGTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949058556 Original CRISPR CTGCAGAAAGGGACTGCAGA GGG (reversed) Intergenic
No off target data available for this crispr