ID: 949061033

View in Genome Browser
Species Human (GRCh38)
Location 2:241957443-241957465
Sequence GGTGAGAGCCAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949061028_949061033 5 Left 949061028 2:241957415-241957437 CCGAAGCAGTGGGGAGGCAGGAT No data
Right 949061033 2:241957443-241957465 GGTGAGAGCCAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949061033 Original CRISPR GGTGAGAGCCAGAAGGTGGA GGG Intergenic
No off target data available for this crispr