ID: 949061397

View in Genome Browser
Species Human (GRCh38)
Location 2:241960020-241960042
Sequence TGGTGTTTGTGGAGAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949061397_949061404 24 Left 949061397 2:241960020-241960042 CCAGCTTTTCTCCACAAACACCA No data
Right 949061404 2:241960067-241960089 TCTAGGGAAGTTCTAGATGAAGG No data
949061397_949061402 8 Left 949061397 2:241960020-241960042 CCAGCTTTTCTCCACAAACACCA No data
Right 949061402 2:241960051-241960073 TTTAACACATGGAACCTCTAGGG No data
949061397_949061400 -3 Left 949061397 2:241960020-241960042 CCAGCTTTTCTCCACAAACACCA No data
Right 949061400 2:241960040-241960062 CCAATTCATCTTTTAACACATGG No data
949061397_949061401 7 Left 949061397 2:241960020-241960042 CCAGCTTTTCTCCACAAACACCA No data
Right 949061401 2:241960050-241960072 TTTTAACACATGGAACCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949061397 Original CRISPR TGGTGTTTGTGGAGAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr