ID: 949070116

View in Genome Browser
Species Human (GRCh38)
Location 2:242019389-242019411
Sequence CGCCCCGCCGGCCTTTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949070116_949070120 -10 Left 949070116 2:242019389-242019411 CCTGTGCAAAGGCCGGCGGGGCG No data
Right 949070120 2:242019402-242019424 CGGCGGGGCGAGAGGACACCGGG No data
949070116_949070128 24 Left 949070116 2:242019389-242019411 CCTGTGCAAAGGCCGGCGGGGCG No data
Right 949070128 2:242019436-242019458 CTGAGGGGCGACCAGCAGGCTGG No data
949070116_949070123 8 Left 949070116 2:242019389-242019411 CCTGTGCAAAGGCCGGCGGGGCG No data
Right 949070123 2:242019420-242019442 CCGGGTGCTCTTCCACCTGAGGG No data
949070116_949070124 9 Left 949070116 2:242019389-242019411 CCTGTGCAAAGGCCGGCGGGGCG No data
Right 949070124 2:242019421-242019443 CGGGTGCTCTTCCACCTGAGGGG No data
949070116_949070121 7 Left 949070116 2:242019389-242019411 CCTGTGCAAAGGCCGGCGGGGCG No data
Right 949070121 2:242019419-242019441 ACCGGGTGCTCTTCCACCTGAGG No data
949070116_949070126 20 Left 949070116 2:242019389-242019411 CCTGTGCAAAGGCCGGCGGGGCG No data
Right 949070126 2:242019432-242019454 CCACCTGAGGGGCGACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949070116 Original CRISPR CGCCCCGCCGGCCTTTGCAC AGG (reversed) Intergenic
No off target data available for this crispr