ID: 949070300

View in Genome Browser
Species Human (GRCh38)
Location 2:242020445-242020467
Sequence TCCACAATCTAAGACATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949070300_949070302 -6 Left 949070300 2:242020445-242020467 CCACTGATGTCTTAGATTGTGGA No data
Right 949070302 2:242020462-242020484 TGTGGAGCTGAAGGCAATGAAGG No data
949070300_949070303 5 Left 949070300 2:242020445-242020467 CCACTGATGTCTTAGATTGTGGA No data
Right 949070303 2:242020473-242020495 AGGCAATGAAGGAGCTGATGTGG No data
949070300_949070306 28 Left 949070300 2:242020445-242020467 CCACTGATGTCTTAGATTGTGGA No data
Right 949070306 2:242020496-242020518 CTGTTCCTCTGTGAGGGTCGTGG No data
949070300_949070304 21 Left 949070300 2:242020445-242020467 CCACTGATGTCTTAGATTGTGGA No data
Right 949070304 2:242020489-242020511 GATGTGGCTGTTCCTCTGTGAGG No data
949070300_949070305 22 Left 949070300 2:242020445-242020467 CCACTGATGTCTTAGATTGTGGA No data
Right 949070305 2:242020490-242020512 ATGTGGCTGTTCCTCTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949070300 Original CRISPR TCCACAATCTAAGACATCAG TGG (reversed) Intergenic
No off target data available for this crispr