ID: 949070304

View in Genome Browser
Species Human (GRCh38)
Location 2:242020489-242020511
Sequence GATGTGGCTGTTCCTCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949070300_949070304 21 Left 949070300 2:242020445-242020467 CCACTGATGTCTTAGATTGTGGA No data
Right 949070304 2:242020489-242020511 GATGTGGCTGTTCCTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949070304 Original CRISPR GATGTGGCTGTTCCTCTGTG AGG Intergenic
No off target data available for this crispr