ID: 949070469

View in Genome Browser
Species Human (GRCh38)
Location 2:242021331-242021353
Sequence CAGGAACATCAGCTCCCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949070469_949070475 5 Left 949070469 2:242021331-242021353 CCTCGGGGGAGCTGATGTTCCTG No data
Right 949070475 2:242021359-242021381 GGGCTGGGAAGCTGATGATCTGG No data
949070469_949070478 25 Left 949070469 2:242021331-242021353 CCTCGGGGGAGCTGATGTTCCTG No data
Right 949070478 2:242021379-242021401 TGGTTTGAGGGCCGTGCAGCTGG No data
949070469_949070473 -10 Left 949070469 2:242021331-242021353 CCTCGGGGGAGCTGATGTTCCTG No data
Right 949070473 2:242021344-242021366 GATGTTCCTGTTTGAGGGCTGGG No data
949070469_949070476 12 Left 949070469 2:242021331-242021353 CCTCGGGGGAGCTGATGTTCCTG No data
Right 949070476 2:242021366-242021388 GAAGCTGATGATCTGGTTTGAGG No data
949070469_949070477 13 Left 949070469 2:242021331-242021353 CCTCGGGGGAGCTGATGTTCCTG No data
Right 949070477 2:242021367-242021389 AAGCTGATGATCTGGTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949070469 Original CRISPR CAGGAACATCAGCTCCCCCG AGG (reversed) Intergenic