ID: 949070473

View in Genome Browser
Species Human (GRCh38)
Location 2:242021344-242021366
Sequence GATGTTCCTGTTTGAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949070464_949070473 6 Left 949070464 2:242021315-242021337 CCGTGCAGCTGGAGACCCTCGGG No data
Right 949070473 2:242021344-242021366 GATGTTCCTGTTTGAGGGCTGGG No data
949070469_949070473 -10 Left 949070469 2:242021331-242021353 CCTCGGGGGAGCTGATGTTCCTG No data
Right 949070473 2:242021344-242021366 GATGTTCCTGTTTGAGGGCTGGG No data
949070461_949070473 18 Left 949070461 2:242021303-242021325 CCAGTTTGAGGGCCGTGCAGCTG No data
Right 949070473 2:242021344-242021366 GATGTTCCTGTTTGAGGGCTGGG No data
949070468_949070473 -9 Left 949070468 2:242021330-242021352 CCCTCGGGGGAGCTGATGTTCCT No data
Right 949070473 2:242021344-242021366 GATGTTCCTGTTTGAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949070473 Original CRISPR GATGTTCCTGTTTGAGGGCT GGG Intergenic