ID: 949070475

View in Genome Browser
Species Human (GRCh38)
Location 2:242021359-242021381
Sequence GGGCTGGGAAGCTGATGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949070464_949070475 21 Left 949070464 2:242021315-242021337 CCGTGCAGCTGGAGACCCTCGGG No data
Right 949070475 2:242021359-242021381 GGGCTGGGAAGCTGATGATCTGG No data
949070468_949070475 6 Left 949070468 2:242021330-242021352 CCCTCGGGGGAGCTGATGTTCCT No data
Right 949070475 2:242021359-242021381 GGGCTGGGAAGCTGATGATCTGG No data
949070469_949070475 5 Left 949070469 2:242021331-242021353 CCTCGGGGGAGCTGATGTTCCTG No data
Right 949070475 2:242021359-242021381 GGGCTGGGAAGCTGATGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949070475 Original CRISPR GGGCTGGGAAGCTGATGATC TGG Intergenic