ID: 949070476

View in Genome Browser
Species Human (GRCh38)
Location 2:242021366-242021388
Sequence GAAGCTGATGATCTGGTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949070474_949070476 -7 Left 949070474 2:242021350-242021372 CCTGTTTGAGGGCTGGGAAGCTG No data
Right 949070476 2:242021366-242021388 GAAGCTGATGATCTGGTTTGAGG No data
949070464_949070476 28 Left 949070464 2:242021315-242021337 CCGTGCAGCTGGAGACCCTCGGG No data
Right 949070476 2:242021366-242021388 GAAGCTGATGATCTGGTTTGAGG No data
949070468_949070476 13 Left 949070468 2:242021330-242021352 CCCTCGGGGGAGCTGATGTTCCT No data
Right 949070476 2:242021366-242021388 GAAGCTGATGATCTGGTTTGAGG No data
949070469_949070476 12 Left 949070469 2:242021331-242021353 CCTCGGGGGAGCTGATGTTCCTG No data
Right 949070476 2:242021366-242021388 GAAGCTGATGATCTGGTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949070476 Original CRISPR GAAGCTGATGATCTGGTTTG AGG Intergenic