ID: 949070478

View in Genome Browser
Species Human (GRCh38)
Location 2:242021379-242021401
Sequence TGGTTTGAGGGCCGTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949070468_949070478 26 Left 949070468 2:242021330-242021352 CCCTCGGGGGAGCTGATGTTCCT No data
Right 949070478 2:242021379-242021401 TGGTTTGAGGGCCGTGCAGCTGG No data
949070474_949070478 6 Left 949070474 2:242021350-242021372 CCTGTTTGAGGGCTGGGAAGCTG No data
Right 949070478 2:242021379-242021401 TGGTTTGAGGGCCGTGCAGCTGG No data
949070469_949070478 25 Left 949070469 2:242021331-242021353 CCTCGGGGGAGCTGATGTTCCTG No data
Right 949070478 2:242021379-242021401 TGGTTTGAGGGCCGTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949070478 Original CRISPR TGGTTTGAGGGCCGTGCAGC TGG Intergenic