ID: 949075760

View in Genome Browser
Species Human (GRCh38)
Location 2:242056763-242056785
Sequence CAGGGGGACTGGAGGGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949075749_949075760 6 Left 949075749 2:242056734-242056756 CCAACCTATTTTATTTTAAGATG No data
Right 949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG No data
949075751_949075760 2 Left 949075751 2:242056738-242056760 CCTATTTTATTTTAAGATGAGGA No data
Right 949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949075760 Original CRISPR CAGGGGGACTGGAGGGCCGT GGG Intergenic
No off target data available for this crispr