ID: 949079861 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:242088457-242088479 |
| Sequence | GCGGGGGGGCGGGGGCGGGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949079861_949079889 | 23 | Left | 949079861 | 2:242088457-242088479 | CCCCCCCGCCCCCGCCCCCCCGC | No data | ||
| Right | 949079889 | 2:242088503-242088525 | CGCCCCCACACCTCCACGCCCGG | 0: 1 1: 1 2: 1 3: 42 4: 459 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949079861 | Original CRISPR | GCGGGGGGGCGGGGGCGGGG GGG (reversed) | Intergenic | ||