ID: 949079866

View in Genome Browser
Species Human (GRCh38)
Location 2:242088462-242088484
Sequence GGGGCGCGGGGGGGCGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949079866_949079889 18 Left 949079866 2:242088462-242088484 CCGCCCCCGCCCCCCCGCGCCCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG 0: 1
1: 1
2: 1
3: 42
4: 459
949079866_949079894 26 Left 949079866 2:242088462-242088484 CCGCCCCCGCCCCCCCGCGCCCC No data
Right 949079894 2:242088511-242088533 CACCTCCACGCCCGGCACTCTGG No data
949079866_949079895 27 Left 949079866 2:242088462-242088484 CCGCCCCCGCCCCCCCGCGCCCC No data
Right 949079895 2:242088512-242088534 ACCTCCACGCCCGGCACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949079866 Original CRISPR GGGGCGCGGGGGGGCGGGGG CGG (reversed) Intergenic