ID: 949079870

View in Genome Browser
Species Human (GRCh38)
Location 2:242088468-242088490
Sequence GGCGCGGGGGCGCGGGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949079870_949079894 20 Left 949079870 2:242088468-242088490 CCGCCCCCCCGCGCCCCCGCGCC No data
Right 949079894 2:242088511-242088533 CACCTCCACGCCCGGCACTCTGG No data
949079870_949079899 30 Left 949079870 2:242088468-242088490 CCGCCCCCCCGCGCCCCCGCGCC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079870_949079895 21 Left 949079870 2:242088468-242088490 CCGCCCCCCCGCGCCCCCGCGCC No data
Right 949079895 2:242088512-242088534 ACCTCCACGCCCGGCACTCTGGG No data
949079870_949079889 12 Left 949079870 2:242088468-242088490 CCGCCCCCCCGCGCCCCCGCGCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG 0: 1
1: 1
2: 1
3: 42
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949079870 Original CRISPR GGCGCGGGGGCGCGGGGGGG CGG (reversed) Intergenic