ID: 949079874

View in Genome Browser
Species Human (GRCh38)
Location 2:242088474-242088496
Sequence CGCGGGGGCGCGGGGGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949079874_949079901 28 Left 949079874 2:242088474-242088496 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079874_949079895 15 Left 949079874 2:242088474-242088496 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079895 2:242088512-242088534 ACCTCCACGCCCGGCACTCTGGG No data
949079874_949079894 14 Left 949079874 2:242088474-242088496 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079894 2:242088511-242088533 CACCTCCACGCCCGGCACTCTGG No data
949079874_949079899 24 Left 949079874 2:242088474-242088496 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079874_949079889 6 Left 949079874 2:242088474-242088496 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG 0: 1
1: 1
2: 1
3: 42
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949079874 Original CRISPR CGCGGGGGCGCGGGGGCGCG GGG (reversed) Intergenic