ID: 949079875

View in Genome Browser
Species Human (GRCh38)
Location 2:242088475-242088497
Sequence GCGCGGGGGCGCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949079875_949079889 5 Left 949079875 2:242088475-242088497 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG 0: 1
1: 1
2: 1
3: 42
4: 459
949079875_949079901 27 Left 949079875 2:242088475-242088497 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079875_949079895 14 Left 949079875 2:242088475-242088497 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079895 2:242088512-242088534 ACCTCCACGCCCGGCACTCTGGG No data
949079875_949079902 30 Left 949079875 2:242088475-242088497 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079902 2:242088528-242088550 CTCTGGGCGCGCGCGGACGGCGG No data
949079875_949079894 13 Left 949079875 2:242088475-242088497 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079894 2:242088511-242088533 CACCTCCACGCCCGGCACTCTGG No data
949079875_949079899 23 Left 949079875 2:242088475-242088497 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949079875 Original CRISPR GCGCGGGGGCGCGGGGGCGC GGG (reversed) Intergenic