ID: 949079876

View in Genome Browser
Species Human (GRCh38)
Location 2:242088476-242088498
Sequence GGCGCGGGGGCGCGGGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949079876_949079899 22 Left 949079876 2:242088476-242088498 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079876_949079903 30 Left 949079876 2:242088476-242088498 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079903 2:242088529-242088551 TCTGGGCGCGCGCGGACGGCGGG No data
949079876_949079895 13 Left 949079876 2:242088476-242088498 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079895 2:242088512-242088534 ACCTCCACGCCCGGCACTCTGGG No data
949079876_949079894 12 Left 949079876 2:242088476-242088498 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079894 2:242088511-242088533 CACCTCCACGCCCGGCACTCTGG No data
949079876_949079902 29 Left 949079876 2:242088476-242088498 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079902 2:242088528-242088550 CTCTGGGCGCGCGCGGACGGCGG No data
949079876_949079889 4 Left 949079876 2:242088476-242088498 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG 0: 1
1: 1
2: 1
3: 42
4: 459
949079876_949079901 26 Left 949079876 2:242088476-242088498 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949079876 Original CRISPR GGCGCGGGGGCGCGGGGGCG CGG (reversed) Intergenic