ID: 949079879

View in Genome Browser
Species Human (GRCh38)
Location 2:242088483-242088505
Sequence GCGCGGGGGCGCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949079879_949079902 22 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079902 2:242088528-242088550 CTCTGGGCGCGCGCGGACGGCGG No data
949079879_949079904 24 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079879_949079895 6 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079895 2:242088512-242088534 ACCTCCACGCCCGGCACTCTGGG No data
949079879_949079894 5 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079894 2:242088511-242088533 CACCTCCACGCCCGGCACTCTGG No data
949079879_949079903 23 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079903 2:242088529-242088551 TCTGGGCGCGCGCGGACGGCGGG No data
949079879_949079901 19 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079879_949079899 15 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079879_949079889 -3 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949079879 Original CRISPR GCGCGGGGGCGCGGGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr