ID: 949079881

View in Genome Browser
Species Human (GRCh38)
Location 2:242088489-242088511
Sequence GTGGGGGCGCGGGGGCGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949079881_949079899 9 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079881_949079904 18 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079881_949079889 -9 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG 0: 1
1: 1
2: 1
3: 42
4: 459
949079881_949079895 0 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079895 2:242088512-242088534 ACCTCCACGCCCGGCACTCTGGG No data
949079881_949079903 17 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079903 2:242088529-242088551 TCTGGGCGCGCGCGGACGGCGGG No data
949079881_949079894 -1 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079894 2:242088511-242088533 CACCTCCACGCCCGGCACTCTGG No data
949079881_949079902 16 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079902 2:242088528-242088550 CTCTGGGCGCGCGCGGACGGCGG No data
949079881_949079901 13 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949079881 Original CRISPR GTGGGGGCGCGGGGGCGCGG GGG (reversed) Intergenic