ID: 949079889

View in Genome Browser
Species Human (GRCh38)
Location 2:242088503-242088525
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 24 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949079875_949079889 5 Left 949079875 2:242088475-242088497 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079860_949079889 29 Left 949079860 2:242088451-242088473 CCTGCGCCCCCCCGCCCCCGCCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079869_949079889 13 Left 949079869 2:242088467-242088489 CCCGCCCCCCCGCGCCCCCGCGC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079871_949079889 9 Left 949079871 2:242088471-242088493 CCCCCCCGCGCCCCCGCGCCCCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079865_949079889 19 Left 949079865 2:242088461-242088483 CCCGCCCCCGCCCCCCCGCGCCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079863_949079889 21 Left 949079863 2:242088459-242088481 CCCCCGCCCCCGCCCCCCCGCGC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079877_949079889 -1 Left 949079877 2:242088481-242088503 CCCCCGCGCCCCCGCGCCCCCGC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079880_949079889 -4 Left 949079880 2:242088484-242088506 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079859_949079889 30 Left 949079859 2:242088450-242088472 CCCTGCGCCCCCCCGCCCCCGCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079873_949079889 7 Left 949079873 2:242088473-242088495 CCCCCGCGCCCCCGCGCCCCCGC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079876_949079889 4 Left 949079876 2:242088476-242088498 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079861_949079889 23 Left 949079861 2:242088457-242088479 CCCCCCCGCCCCCGCCCCCCCGC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079872_949079889 8 Left 949079872 2:242088472-242088494 CCCCCCGCGCCCCCGCGCCCCCG No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079882_949079889 -10 Left 949079882 2:242088490-242088512 CCCCGCGCCCCCGCGCCCCCACA No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079862_949079889 22 Left 949079862 2:242088458-242088480 CCCCCCGCCCCCGCCCCCCCGCG No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079868_949079889 14 Left 949079868 2:242088466-242088488 CCCCGCCCCCCCGCGCCCCCGCG No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079864_949079889 20 Left 949079864 2:242088460-242088482 CCCCGCCCCCGCCCCCCCGCGCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079867_949079889 15 Left 949079867 2:242088465-242088487 CCCCCGCCCCCCCGCGCCCCCGC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079881_949079889 -9 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079879_949079889 -3 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079874_949079889 6 Left 949079874 2:242088474-242088496 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079870_949079889 12 Left 949079870 2:242088468-242088490 CCGCCCCCCCGCGCCCCCGCGCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079878_949079889 -2 Left 949079878 2:242088482-242088504 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data
949079866_949079889 18 Left 949079866 2:242088462-242088484 CCGCCCCCGCCCCCCCGCGCCCC No data
Right 949079889 2:242088503-242088525 CGCCCCCACACCTCCACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type