ID: 949079896 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:242088513-242088535 |
Sequence | GCCCAGAGTGCCGGGCGTGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 6 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
949079896_949079907 | 24 | Left | 949079896 | 2:242088513-242088535 | CCTCCACGCCCGGCACTCTGGGC | No data | ||
Right | 949079907 | 2:242088560-242088582 | TACTACGCAGGCGCACGCTGCGG | No data | ||||
949079896_949079908 | 25 | Left | 949079896 | 2:242088513-242088535 | CCTCCACGCCCGGCACTCTGGGC | No data | ||
Right | 949079908 | 2:242088561-242088583 | ACTACGCAGGCGCACGCTGCGGG | No data | ||||
949079896_949079904 | -6 | Left | 949079896 | 2:242088513-242088535 | CCTCCACGCCCGGCACTCTGGGC | No data | ||
Right | 949079904 | 2:242088530-242088552 | CTGGGCGCGCGCGGACGGCGGGG | No data | ||||
949079896_949079905 | 12 | Left | 949079896 | 2:242088513-242088535 | CCTCCACGCCCGGCACTCTGGGC | No data | ||
Right | 949079905 | 2:242088548-242088570 | CGGGGCAGTGCCTACTACGCAGG | No data | ||||
949079896_949079903 | -7 | Left | 949079896 | 2:242088513-242088535 | CCTCCACGCCCGGCACTCTGGGC | No data | ||
Right | 949079903 | 2:242088529-242088551 | TCTGGGCGCGCGCGGACGGCGGG | No data | ||||
949079896_949079902 | -8 | Left | 949079896 | 2:242088513-242088535 | CCTCCACGCCCGGCACTCTGGGC | No data | ||
Right | 949079902 | 2:242088528-242088550 | CTCTGGGCGCGCGCGGACGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
949079896 | Original CRISPR | GCCCAGAGTGCCGGGCGTGG AGG (reversed) | Intergenic | ||