ID: 949079899

View in Genome Browser
Species Human (GRCh38)
Location 2:242088521-242088543
Sequence CCCGGCACTCTGGGCGCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 23 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949079873_949079899 25 Left 949079873 2:242088473-242088495 CCCCCGCGCCCCCGCGCCCCCGC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079878_949079899 16 Left 949079878 2:242088482-242088504 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079884_949079899 6 Left 949079884 2:242088492-242088514 CCGCGCCCCCGCGCCCCCACACC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079887_949079899 -1 Left 949079887 2:242088499-242088521 CCCGCGCCCCCACACCTCCACGC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079885_949079899 1 Left 949079885 2:242088497-242088519 CCCCCGCGCCCCCACACCTCCAC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079892_949079899 -9 Left 949079892 2:242088507-242088529 CCCACACCTCCACGCCCGGCACT No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079893_949079899 -10 Left 949079893 2:242088508-242088530 CCACACCTCCACGCCCGGCACTC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079888_949079899 -2 Left 949079888 2:242088500-242088522 CCGCGCCCCCACACCTCCACGCC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079875_949079899 23 Left 949079875 2:242088475-242088497 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079874_949079899 24 Left 949079874 2:242088474-242088496 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079883_949079899 7 Left 949079883 2:242088491-242088513 CCCGCGCCCCCGCGCCCCCACAC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079879_949079899 15 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079877_949079899 17 Left 949079877 2:242088481-242088503 CCCCCGCGCCCCCGCGCCCCCGC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079891_949079899 -8 Left 949079891 2:242088506-242088528 CCCCACACCTCCACGCCCGGCAC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079882_949079899 8 Left 949079882 2:242088490-242088512 CCCCGCGCCCCCGCGCCCCCACA No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079881_949079899 9 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079870_949079899 30 Left 949079870 2:242088468-242088490 CCGCCCCCCCGCGCCCCCGCGCC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079871_949079899 27 Left 949079871 2:242088471-242088493 CCCCCCCGCGCCCCCGCGCCCCC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079890_949079899 -7 Left 949079890 2:242088505-242088527 CCCCCACACCTCCACGCCCGGCA No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079876_949079899 22 Left 949079876 2:242088476-242088498 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079880_949079899 14 Left 949079880 2:242088484-242088506 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079886_949079899 0 Left 949079886 2:242088498-242088520 CCCCGCGCCCCCACACCTCCACG No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data
949079872_949079899 26 Left 949079872 2:242088472-242088494 CCCCCCGCGCCCCCGCGCCCCCG No data
Right 949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949079899 Original CRISPR CCCGGCACTCTGGGCGCGCG CGG Intergenic