ID: 949079901

View in Genome Browser
Species Human (GRCh38)
Location 2:242088525-242088547
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 21 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949079888_949079901 2 Left 949079888 2:242088500-242088522 CCGCGCCCCCACACCTCCACGCC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079878_949079901 20 Left 949079878 2:242088482-242088504 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079877_949079901 21 Left 949079877 2:242088481-242088503 CCCCCGCGCCCCCGCGCCCCCGC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079874_949079901 28 Left 949079874 2:242088474-242088496 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079872_949079901 30 Left 949079872 2:242088472-242088494 CCCCCCGCGCCCCCGCGCCCCCG No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079886_949079901 4 Left 949079886 2:242088498-242088520 CCCCGCGCCCCCACACCTCCACG No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079880_949079901 18 Left 949079880 2:242088484-242088506 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079891_949079901 -4 Left 949079891 2:242088506-242088528 CCCCACACCTCCACGCCCGGCAC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079879_949079901 19 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079883_949079901 11 Left 949079883 2:242088491-242088513 CCCGCGCCCCCGCGCCCCCACAC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079881_949079901 13 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079882_949079901 12 Left 949079882 2:242088490-242088512 CCCCGCGCCCCCGCGCCCCCACA No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079876_949079901 26 Left 949079876 2:242088476-242088498 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079875_949079901 27 Left 949079875 2:242088475-242088497 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079873_949079901 29 Left 949079873 2:242088473-242088495 CCCCCGCGCCCCCGCGCCCCCGC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079887_949079901 3 Left 949079887 2:242088499-242088521 CCCGCGCCCCCACACCTCCACGC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079885_949079901 5 Left 949079885 2:242088497-242088519 CCCCCGCGCCCCCACACCTCCAC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079890_949079901 -3 Left 949079890 2:242088505-242088527 CCCCCACACCTCCACGCCCGGCA No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079893_949079901 -6 Left 949079893 2:242088508-242088530 CCACACCTCCACGCCCGGCACTC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079884_949079901 10 Left 949079884 2:242088492-242088514 CCGCGCCCCCGCGCCCCCACACC No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data
949079892_949079901 -5 Left 949079892 2:242088507-242088529 CCCACACCTCCACGCCCGGCACT No data
Right 949079901 2:242088525-242088547 GCACTCTGGGCGCGCGCGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type