ID: 949079904

View in Genome Browser
Species Human (GRCh38)
Location 2:242088530-242088552
Sequence CTGGGCGCGCGCGGACGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949079887_949079904 8 Left 949079887 2:242088499-242088521 CCCGCGCCCCCACACCTCCACGC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079897_949079904 -9 Left 949079897 2:242088516-242088538 CCACGCCCGGCACTCTGGGCGCG No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079877_949079904 26 Left 949079877 2:242088481-242088503 CCCCCGCGCCCCCGCGCCCCCGC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079891_949079904 1 Left 949079891 2:242088506-242088528 CCCCACACCTCCACGCCCGGCAC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079879_949079904 24 Left 949079879 2:242088483-242088505 CCCGCGCCCCCGCGCCCCCGCGC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079881_949079904 18 Left 949079881 2:242088489-242088511 CCCCCGCGCCCCCGCGCCCCCAC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079885_949079904 10 Left 949079885 2:242088497-242088519 CCCCCGCGCCCCCACACCTCCAC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079882_949079904 17 Left 949079882 2:242088490-242088512 CCCCGCGCCCCCGCGCCCCCACA No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079883_949079904 16 Left 949079883 2:242088491-242088513 CCCGCGCCCCCGCGCCCCCACAC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079880_949079904 23 Left 949079880 2:242088484-242088506 CCGCGCCCCCGCGCCCCCGCGCC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079893_949079904 -1 Left 949079893 2:242088508-242088530 CCACACCTCCACGCCCGGCACTC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079878_949079904 25 Left 949079878 2:242088482-242088504 CCCCGCGCCCCCGCGCCCCCGCG No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079890_949079904 2 Left 949079890 2:242088505-242088527 CCCCCACACCTCCACGCCCGGCA No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079888_949079904 7 Left 949079888 2:242088500-242088522 CCGCGCCCCCACACCTCCACGCC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079884_949079904 15 Left 949079884 2:242088492-242088514 CCGCGCCCCCGCGCCCCCACACC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079886_949079904 9 Left 949079886 2:242088498-242088520 CCCCGCGCCCCCACACCTCCACG No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079892_949079904 0 Left 949079892 2:242088507-242088529 CCCACACCTCCACGCCCGGCACT No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data
949079896_949079904 -6 Left 949079896 2:242088513-242088535 CCTCCACGCCCGGCACTCTGGGC No data
Right 949079904 2:242088530-242088552 CTGGGCGCGCGCGGACGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949079904 Original CRISPR CTGGGCGCGCGCGGACGGCG GGG Intergenic