ID: 949082595

View in Genome Browser
Species Human (GRCh38)
Location 2:242116334-242116356
Sequence CTTTTGCAATGTCAGATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 3, 2: 1, 3: 20, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949082595 Original CRISPR CTTTTGCAATGTCAGATCTA TGG Intergenic
900075127 1:808450-808472 CTTTTGCAATATCAGATCTATGG - Intergenic
909737291 1:78978374-78978396 CTTCTACAATGTCAGCTATATGG - Intronic
910506449 1:87954763-87954785 CTTTTGCAGTGTCAGATTTGTGG + Intergenic
915812937 1:158935252-158935274 CTTCTGAAATGTAAGATATAAGG + Intronic
916156803 1:161858741-161858763 CTTTTGCATTTTCAGCTGTATGG - Intronic
917121605 1:171649390-171649412 CTGTTTCAAGGCCAGATCTAGGG - Intronic
922270967 1:224033349-224033371 CTTTTGCAATATCAGATCTATGG - Intergenic
1063167650 10:3478670-3478692 CTTTTGGAATATCAGCTCCAGGG - Intergenic
1063359999 10:5445374-5445396 CTTTTGCAAATTCAAAACTAAGG - Intronic
1064551452 10:16505204-16505226 CTTTTTGATTGTCATATCTAGGG + Intronic
1065451518 10:25863496-25863518 ATTTTGTAATGACACATCTAGGG - Intergenic
1065816118 10:29484273-29484295 CTTTTGCACTTTCAGATCAATGG + Intronic
1065956784 10:30700623-30700645 CTTTTGCACTTTCAGATCAATGG - Intergenic
1069289250 10:66756886-66756908 GTTTTGCAATTTCTGCTCTAGGG - Intronic
1071057835 10:81531400-81531422 ATTTTGCATTGTCAGAACTTTGG - Intergenic
1071104750 10:82081229-82081251 CTCTTGGAATGTCAGATCTTGGG - Intronic
1072901475 10:99411323-99411345 CTTTTCCACTTTCAGATCTTAGG - Intronic
1078240804 11:9529525-9529547 TTTGAGCAAAGTCAGATCTAAGG - Intergenic
1079312437 11:19378587-19378609 CTTTTGAAATGGCAGATGGAGGG + Intronic
1081453556 11:43197744-43197766 AATTTGCAATGTCAGATATGAGG - Intergenic
1084350916 11:68598512-68598534 CTTTTGCATCTTCAGATCTCTGG + Intronic
1085007228 11:73103932-73103954 CTTTTGCAATGTCTGAAACAAGG + Intronic
1086320281 11:85639181-85639203 CTTCTGCAATGTCTAATCTTGGG - Intergenic
1087125243 11:94619187-94619209 CTTTTGTAATGACAGATATTAGG + Intronic
1089275499 11:117332980-117333002 TGTTTGCCATGGCAGATCTAAGG + Intronic
1090444435 11:126751554-126751576 ATTTTGGAATGTGAGATCTTAGG + Intronic
1090668099 11:128928297-128928319 CTTTTGCAATATGAGATCTCAGG + Intergenic
1091614491 12:2039034-2039056 CTTTTGCAATTTCCTACCTATGG - Intronic
1092692274 12:11127452-11127474 TTTTTTCAATGCCAGATTTATGG + Intronic
1093541390 12:20290469-20290491 ATTATGCAATGTCTGCTCTAAGG - Intergenic
1099579433 12:84424234-84424256 CTTCACCAATGACAGATCTATGG + Intergenic
1100170476 12:91969917-91969939 CTATTGCAATGACAGCACTAAGG + Intergenic
1101130958 12:101690687-101690709 CTTTTGCAATTTCAGATAAAGGG + Intergenic
1103531936 12:121608484-121608506 CGTTTGCAATGTCAGCACTTTGG - Intergenic
1104711282 12:130988583-130988605 CTCTTGCAATGGAAGCTCTAGGG + Intronic
1105268739 13:18849095-18849117 CTTTTTAAAAGTCAGAACTATGG + Intergenic
1110474408 13:75896984-75897006 CTGTTGCAATGACAGATCTCTGG + Intergenic
1110639010 13:77799915-77799937 CTTTTGCAAGATCAGAAATAAGG + Intergenic
1112577429 13:100648142-100648164 CTGTGGCAATTTCAGATCAAAGG + Intronic
1115036858 14:28868353-28868375 CTTTTGCAATAGCAAAACTAAGG - Intergenic
1115716799 14:36114536-36114558 CTCTTGCAAGGTCAGATCAAGGG - Intergenic
1117626906 14:57649840-57649862 CTTTTGAAATATCAAATCTCTGG - Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1117962212 14:61174606-61174628 CTTTTGCAGAGACAGATCTAGGG + Intergenic
1121028432 14:90634908-90634930 CTTTTGCTATGACACATCTAGGG - Intronic
1121773258 14:96571707-96571729 CTTATCCAAAGTCAGATGTAGGG + Intergenic
1122518045 14:102322267-102322289 CTTTTGAAAGGGCAGATCTTGGG + Intronic
1202830567 14_GL000009v2_random:24859-24881 CTTTTTAAAAGTCAGAACTATGG - Intergenic
1124414742 15:29465923-29465945 CTTCAGCAATGCCAGATCTCAGG - Intronic
1126209901 15:46090051-46090073 AGTTTGCAATGCCAGATTTATGG - Intergenic
1132062408 15:98703173-98703195 CTTTTGGAATGTGAGATCCCAGG - Intronic
1134298698 16:12970180-12970202 TTTTTTCAATGACAGATTTAGGG + Intronic
1137550717 16:49435714-49435736 CTTTAGAAATGTCAGATCTGGGG - Intergenic
1140908861 16:79433159-79433181 CTTTGGCAATGAAAGATTTAAGG - Intergenic
1144660452 17:17064599-17064621 TTCTTGAAATGTCAGATTTATGG - Intronic
1147464097 17:40597522-40597544 TCTTTTCAATGTCAGATTTAGGG + Intergenic
1154419284 18:14210902-14210924 CTTTTTAAAAGTCAGAACTATGG - Intergenic
1156578042 18:38342285-38342307 ATTTTGGAATCTCAGATTTAGGG + Intergenic
1157870294 18:51224104-51224126 CTCTTGAAATGTAAGATATAGGG - Intergenic
1158423385 18:57315530-57315552 ATTTTGCAGTTTCAGATCTGAGG + Intergenic
1158795831 18:60845259-60845281 CTTATGCAATATAAGATTTAAGG + Intergenic
1159242142 18:65755133-65755155 CTTTTGCAATGTGTGATCTTTGG - Intronic
1159322562 18:66872170-66872192 TTTTTGCAAGTTCTGATCTATGG + Intergenic
1164942218 19:32259645-32259667 CCTTTGTCATGTCAGATATATGG - Intergenic
1166802836 19:45468812-45468834 CCTTTTCCATCTCAGATCTAGGG - Intronic
1167467539 19:49658202-49658224 CTTTTGCTGTGGCAGATCTGGGG - Exonic
1202642128 1_KI270706v1_random:102919-102941 CTTTTTAAAAGTCAGAACTATGG + Intergenic
925493476 2:4421506-4421528 CTTTTGAAATGCCTGATCTGTGG + Intergenic
925890655 2:8431439-8431461 CATTTGCAAAGTCCCATCTAAGG - Intergenic
928847066 2:35688947-35688969 ATTTTGCAATGTTTGATTTATGG - Intergenic
931975680 2:67641599-67641621 CTTTTGCAATTTCTCATCTAAGG + Intergenic
935145538 2:100392747-100392769 CTTTTGCAGCATCAGATCTGAGG - Exonic
937208394 2:120251999-120252021 CTTATGCAATGTGATATCCATGG - Intronic
939915583 2:148039104-148039126 TTTTTGAGATGACAGATCTAAGG - Intronic
942580481 2:177411641-177411663 ATTTTTCCATGTCAGATCAAAGG + Intronic
949082595 2:242116334-242116356 CTTTTGCAATGTCAGATCTATGG + Intergenic
1173097441 20:40049461-40049483 CTTTAACAATGCCAGATCTTTGG - Intergenic
1176609752 21:8869697-8869719 CTTTTTAAAAGTCAGAACTATGG - Intergenic
1176854022 21:13948391-13948413 CTTTTTAAAAGTCAGAACTATGG + Intergenic
1177179927 21:17734179-17734201 CTATTGCAATGACAGCTCCAAGG + Intergenic
1178010304 21:28277451-28277473 CTTTTTCAATGTCTTCTCTATGG + Intergenic
1178198587 21:30377336-30377358 CTTTTGTAAAGTCAGATCTGTGG + Intronic
1179079076 21:38153507-38153529 CTTTTGCAATGCCAGCTGAAAGG - Intronic
1180359810 22:11878939-11878961 CTTTTTAAAAGTCAGAACTATGG - Intergenic
1180504044 22:15974085-15974107 TTTATGCAATGTGAGACCTATGG + Intergenic
1182174506 22:28270417-28270439 GTTAGGCAATGTCTGATCTAGGG - Intronic
1184664938 22:45983329-45983351 CTTTTATAATCTTAGATCTAGGG - Intergenic
1203334533 22_KI270739v1_random:48427-48449 TTTATGCAATGTGAGACCTATGG - Intergenic
955505587 3:59629874-59629896 CTTTTGCAAAGACAGCTTTAAGG - Intergenic
955634718 3:61014930-61014952 CTTTTAAAATGTCATATATATGG - Intronic
956221363 3:66907369-66907391 CTTTTGCAATATGAGCTCTCCGG - Intergenic
956298186 3:67737738-67737760 CTTTTGAAATGTCAGACTTCTGG - Intergenic
958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG + Exonic
960115551 3:113888795-113888817 TTTTTGCAAGAACAGATCTATGG - Intronic
960439254 3:117666557-117666579 CTTTTGCACTGGCAGAACTCAGG - Intergenic
960460834 3:117933103-117933125 CTAGTGCAATGTCTGATATATGG + Intergenic
960819878 3:121718129-121718151 CCTTTGCCATTTTAGATCTAGGG - Intronic
963483777 3:145910202-145910224 CTTTTACAATGTCAGGACTGAGG + Intergenic
964813123 3:160687072-160687094 CATTTGAAATGACAGTTCTAAGG - Intergenic
966218231 3:177524753-177524775 CTTTTGCAGTATCAGATCCGAGG + Intergenic
966520859 3:180871899-180871921 CTTTTGCAAAGACAGATAGATGG - Intronic
967528922 3:190527011-190527033 CTTTAGCTATGTCAGATGTATGG - Intronic
967617349 3:191586751-191586773 CTTCTGCAATATCTGATGTATGG + Intergenic
970565605 4:17329472-17329494 CTTTTTCAGTGTCAGATATTTGG - Intergenic
972445628 4:39140820-39140842 CATTTGCAATGTCACAAGTATGG - Intergenic
981379118 4:144051438-144051460 CCTTTGCAATGTCAGATAAAAGG + Intergenic
982557985 4:156893070-156893092 ATATTGCAATGTCAAATATAAGG - Intronic
984637610 4:182128838-182128860 CTTCTGTAATGTCAAATCAAAGG - Intergenic
985973488 5:3395359-3395381 CTTTTGCAAAGATTGATCTAAGG - Intergenic
986918704 5:12659499-12659521 AGTTTGCAATGCCAGATGTAGGG - Intergenic
990233746 5:53743893-53743915 TTTTTACAGTTTCAGATCTAAGG - Intergenic
993607555 5:90012359-90012381 CTTTTTAAATTTAAGATCTATGG - Intergenic
994267825 5:97738860-97738882 TTTTTGCCATGCCAGATCAAGGG + Intergenic
994448245 5:99905687-99905709 CTTCTACAATTTCAGATATAGGG + Intergenic
999985989 5:157005909-157005931 CTATTGCAATGCCAGTTCCATGG - Intergenic
1001299151 5:170521528-170521550 CATTTGCAATGTCATGTCTGTGG + Intronic
1005028078 6:21483082-21483104 CTTTTGAAATATCAGTTCTAGGG - Intergenic
1005141744 6:22639814-22639836 CTTTTGAAATCTCATATCTTAGG + Intergenic
1008365513 6:50674719-50674741 CATTTGCAATGTCATTTCTCTGG - Intergenic
1008442530 6:51548738-51548760 CCTTTGCAAGGTCAGATTCATGG + Intergenic
1008815939 6:55566549-55566571 CTGTTGCAATGTCTAAGCTATGG - Intronic
1011173101 6:84528352-84528374 CTTTTGAAATGACAAATCAAGGG - Intergenic
1012290970 6:97455009-97455031 CTTTTGTCATGTCACATCAAGGG - Intergenic
1014109413 6:117603226-117603248 CTTTTGAAATGTGTGACCTATGG - Intergenic
1015733667 6:136374528-136374550 CTTTTTCAGTGTCAGACCCATGG - Intronic
1020825160 7:13017805-13017827 CTTGTGCAATTTCACATATAAGG - Intergenic
1021241829 7:18211716-18211738 CTTTTGCATTCTCAGAGCTTAGG - Intronic
1023316161 7:38939476-38939498 CTTTTGTAATTTCAGTTCTGGGG + Intergenic
1030938168 7:115612671-115612693 CTTCTTCAATGTCAGATATGAGG + Intergenic
1031407416 7:121403356-121403378 CATTTGCCACATCAGATCTATGG + Intergenic
1031930871 7:127684617-127684639 CTTTTGGAATGTCAGTTCCCTGG + Intronic
1032886838 7:136149630-136149652 CTTTTGCAATGTTTAATCTGCGG + Intergenic
1035540521 8:433037-433059 CTTTTGCAATATCAGATCTATGG + Intronic
1037280467 8:17236004-17236026 CTTTTGCACCTTCATATCTAGGG + Intronic
1038646020 8:29363042-29363064 CTTCTGCAATGTAAGGTCTTGGG - Intergenic
1049127500 8:140805054-140805076 GTTTTGCCATGGCAGAACTAGGG - Intronic
1049878403 8:145043541-145043563 TTCTTGCAAGGTTAGATCTACGG + Intergenic
1050062897 9:1729169-1729191 CTTTTTCATTGTCAGAGCTTTGG + Intergenic
1054360220 9:64106869-64106891 CTTTTTAAAAGTCAGAACTATGG - Intergenic
1055042574 9:71891265-71891287 CTTATGAAATTTCAGAGCTAAGG - Intronic
1055171357 9:73262516-73262538 CTTTTTCGTTGTCACATCTAAGG + Intergenic
1056334466 9:85552956-85552978 GTATTGAAATGTCAGATTTAGGG + Intronic
1059344124 9:113616730-113616752 CTTATTCACTGTCAGATCTCAGG + Intergenic
1059840183 9:118206195-118206217 CTATTGCAATCTCAGCTCTTTGG - Intergenic
1060384215 9:123208300-123208322 CTTTTGTTAGGACAGATCTATGG + Intronic
1061769618 9:132908419-132908441 CTTTTGCAATTACATATCTGTGG - Intronic
1188620428 X:32215121-32215143 CTTTTTCAAAGTCTAATCTATGG - Intronic
1191732347 X:64350852-64350874 ATTTTGCAATGTCAGGTCTGTGG - Intronic
1192830299 X:74744235-74744257 CTTTTGCAATGCCAGATGTGAGG + Exonic
1197235464 X:124057776-124057798 CTGTTTCAATTTCATATCTAAGG - Intronic
1198607650 X:138360214-138360236 ATTTTGGAAGGTAAGATCTATGG + Intergenic