ID: 949093265

View in Genome Browser
Species Human (GRCh38)
Location 3:54833-54855
Sequence CAGGATTAGGTCATAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949093262_949093265 -2 Left 949093262 3:54812-54834 CCTAGATTAAGGCATGTGTTGCA No data
Right 949093265 3:54833-54855 CAGGATTAGGTCATAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949093265 Original CRISPR CAGGATTAGGTCATAGAGAC AGG Intergenic
No off target data available for this crispr