ID: 949093960

View in Genome Browser
Species Human (GRCh38)
Location 3:63670-63692
Sequence CCTAGACACAATGTTTTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949093960_949093970 11 Left 949093960 3:63670-63692 CCTGGTAAAACATTGTGTCTAGG No data
Right 949093970 3:63704-63726 CCAGGCATGTTGCCTTCCTCTGG No data
949093960_949093963 -7 Left 949093960 3:63670-63692 CCTGGTAAAACATTGTGTCTAGG No data
Right 949093963 3:63686-63708 GTCTAGGGATGCCCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949093960 Original CRISPR CCTAGACACAATGTTTTACC AGG (reversed) Intergenic
No off target data available for this crispr