ID: 949093963

View in Genome Browser
Species Human (GRCh38)
Location 3:63686-63708
Sequence GTCTAGGGATGCCCCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949093959_949093963 -2 Left 949093959 3:63665-63687 CCATACCTGGTAAAACATTGTGT No data
Right 949093963 3:63686-63708 GTCTAGGGATGCCCCACCCCAGG No data
949093960_949093963 -7 Left 949093960 3:63670-63692 CCTGGTAAAACATTGTGTCTAGG No data
Right 949093963 3:63686-63708 GTCTAGGGATGCCCCACCCCAGG No data
949093958_949093963 -1 Left 949093958 3:63664-63686 CCCATACCTGGTAAAACATTGTG No data
Right 949093963 3:63686-63708 GTCTAGGGATGCCCCACCCCAGG No data
949093956_949093963 19 Left 949093956 3:63644-63666 CCAGGGGCATAGAGACTTCTCCC No data
Right 949093963 3:63686-63708 GTCTAGGGATGCCCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949093963 Original CRISPR GTCTAGGGATGCCCCACCCC AGG Intergenic
No off target data available for this crispr