ID: 949094800

View in Genome Browser
Species Human (GRCh38)
Location 3:73513-73535
Sequence TTTGAATTGCAAATGAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949094800_949094807 18 Left 949094800 3:73513-73535 CCAGGTTTCATTTGCAATTCAAA No data
Right 949094807 3:73554-73576 AATGTGGTCTTTAAAGGGAAGGG No data
949094800_949094805 13 Left 949094800 3:73513-73535 CCAGGTTTCATTTGCAATTCAAA No data
Right 949094805 3:73549-73571 CATTGAATGTGGTCTTTAAAGGG No data
949094800_949094806 17 Left 949094800 3:73513-73535 CCAGGTTTCATTTGCAATTCAAA No data
Right 949094806 3:73553-73575 GAATGTGGTCTTTAAAGGGAAGG No data
949094800_949094804 12 Left 949094800 3:73513-73535 CCAGGTTTCATTTGCAATTCAAA No data
Right 949094804 3:73548-73570 TCATTGAATGTGGTCTTTAAAGG No data
949094800_949094801 2 Left 949094800 3:73513-73535 CCAGGTTTCATTTGCAATTCAAA No data
Right 949094801 3:73538-73560 GACAACCCTATCATTGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949094800 Original CRISPR TTTGAATTGCAAATGAAACC TGG (reversed) Intergenic
No off target data available for this crispr