ID: 949096815

View in Genome Browser
Species Human (GRCh38)
Location 3:96192-96214
Sequence CTTCTCAGTGGAACACAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949096815_949096820 12 Left 949096815 3:96192-96214 CCCTCTTGTGTTCCACTGAGAAG No data
Right 949096820 3:96227-96249 TATCGGCTGAGAACTGCCCTAGG No data
949096815_949096819 -5 Left 949096815 3:96192-96214 CCCTCTTGTGTTCCACTGAGAAG No data
Right 949096819 3:96210-96232 AGAAGTGGAAGAACTTTTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949096815 Original CRISPR CTTCTCAGTGGAACACAAGA GGG (reversed) Intergenic
No off target data available for this crispr