ID: 949099684

View in Genome Browser
Species Human (GRCh38)
Location 3:128972-128994
Sequence ATTGAGAAGGCCTCAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949099684_949099687 26 Left 949099684 3:128972-128994 CCTTCCTCTGAGGCCTTCTCAAT No data
Right 949099687 3:129021-129043 AGATGCTAAAGTAGCTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949099684 Original CRISPR ATTGAGAAGGCCTCAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr